Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000184950 (click for geneview)
Transcript ID ENST00000333662(link to ensembl)
Localtion Chromosome:16:33518746:33520741:1 band: 16p11.2
Description  
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-L--L--L--L--G--L--W--V--L--L--T--P--V--R--C--S--Q--G--H--P--S--W--H--Y--A--S--S--K--V--V--I--P--R--
CTCTTGCTGCTGGGGCTCTGGGTGCTCCTGACTCCAGTCCGGTGTTCTCAAGGCCATCCCTCGTGGCACTACGCATCCTCCAAGGTGGTGATTCCCAGGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
K--E--T--H--H--G--K--D--L--Q--F--L--G--W--L--S--Y--S--L--H--F--G--G--Q--R--H--I--I--H--M--R--R--K--H
AGGAGACGCACCACGGCAAAGACCTTCAGTTTCTGGGCTGGCTGTCCTACAGCCTGCATTTTGGGGGTCAAAGACACATCATTCACATGCGGAGGAAACA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--L--L--W--P--R--H--L--L--V--T--T--Q--D--D--Q--G--A--L--Q--M--D--D--P--Y--I--P--P--D--C--Y--Y--L--S-
CCTTCTTTGGCCCAGACATCTGCTGGTGACAACTCAGGATGACCAAGGAGCCTTGCAGATGGATGACCCCTACATCCCTCCAGACTGCTACTATCTCAGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-Y--L--E--E--V--P--L--S--M--V--T--V--D--M--C--C--G--G--L--R--G--I--M--K--L--D--D--L--A--Y--E--I--K--
TACCTGGAGGAGGTTCCTCTGTCCATGGTCACCGTGGACATGTGCTGTGGGGGCCTCAGAGGCATCATGAAGCTGGACGACCTTGCCTATGAAATCAAAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
P--L--Q--D--S--R--R--L--E--H--V--S--Q--I--V--A--E--P--N--A--M--G--P--T--F--R--D--G--D--N--E--E--T--N
CCCTCCAGGATTCCCGCAGGCTTGAACATGTTTCTCAGATAGTGGCCGAGCCCAACGCAATGGGGCCCACATTTAGAGATGGTGACAATGAGGAGACAAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--P--L--F--S--E--A--N--D--S--M--N--P--R--I--S--N--W--L--Y--S--S--H--R--G--N--I--K--G--H--V--Q--C--S-
CCCCCTGTTCTCTGAAGCAAATGACAGCATGAATCCCAGGATATCTAATTGGCTGTATAGTTCTCATAGAGGCAATATAAAAGGCCACGTTCAATGTTCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-N--S--Y--C--R--V--D--D--N--I--T--T--C--S--K--E--V--V--Q--M--F--S--L--S--D--S--I--V--Q--N--I--D--L--
AATTCATATTGTCGTGTAGATGACAATATTACAACTTGTTCCAAGGAGGTGGTCCAGATGTTCAGTCTCAGTGACAGCATTGTTCAAAATATTGATCTGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
R--Y--Y--I--Y--L--L--T--I--Y--N--N--C--D--P--A--P--V--N--D--Y--R--V--Q--S--A--M--F--T--Y--F--R--T--T
GGTACTATATTTATCTTTTGACCATATATAATAATTGTGACCCAGCCCCTGTGAATGACTATCGAGTTCAGAGTGCAATGTTTACCTATTTTAGAACAAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--F--F--D--T--F--R--V--H--S--P--T--L--L--I--K--E--A--P--H--E--C--N--Y--E--P--Q--R--Y--S--F--C--T--H-
CTTTTTTGATACTTTTCGTGTTCATTCACCCACACTACTTATTAAAGAGGCACCACATGAATGTAACTATGAACCACAAAGGTATAGCTTCTGTACACAT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------------------------------------------------------------------------><---
-L--G--L--L--H--I--G--T--L--G--R--H--Y--L--L--V--A--V--I--T--T--Q--T--L--M--R--S--T--G--E--K--Y--D--
TTAGGCCTATTACACATTGGTACTCTAGGCAGACATTATTTATTAGTAGCCGTCATAACAACCCAGACACTGATGAGAAGTACTGGTGAGAAGTACGATG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
D--N--Y--C--T--C--Q--K--R--A--F--C--I--M--Q--Q--Y--P--G--M--T--D--A--F--S--N--C--S--Y--G--H--A--Q--N
ATAACTACTGCACATGTCAGAAAAGGGCCTTCTGCATTATGCAGCAATATCCTGGGATGACAGATGCGTTCAGTAACTGTTCTTATGGACATGCACAAAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--C--F--V--H--S--A--R--C--V--F--K--T--L--A--P--V--Y--N--E--T--M--T--M--V--R--C--G--N--L--I--A--D--G-
TTGTTTTGTACATTCAGCCCGGTGTGTTTTCAAAACACTTGCTCCTGTGTATAATGAAACCATGACAATGGTTCGCTGTGGAAACCTCATAGCGGATGGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------><-------------------------------------------------------------------
-R--E--E--C--D--C--G--S--F--K--Y--Y--C--C--R--S--D--C--R--L--T--P--G--S--I--C--H--I--G--E--C--C--T--
AGGGAGGAATGTGACTGTGGCTCCTTCAAGTATTATTGCTGCCGAAGTGACTGTCGCTTAACACCGGGGAGCATCTGTCATATAGGAGAGTGCTGTACAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
N--C--S--Y--S--P--P--G--T--L--C--R--P--I--Q--N--I--C--D--L--P--E--Y--C--H--G--T--T--V--T--C--P--A--N
ACTGCAGCTACTCCCCACCAGGGACTCTCTGCAGACCTATCCAAAATATATGTGACCTTCCAGAGTACTGTCACGGGACCACCGTGACATGCCCCGCAAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--F--Y--M--Q--D--G--T--P--C--T--E--E--G--Y--C--Y--H--G--N--C--T--D--R--N--V--L--C--K--V--I--F--G--V-
CTTTTATATGCAAGATGGAACCCCGTGCACTGAAGAAGGCTACTGCTATCATGGGAACTGCACTGACCGCAATGTGCTCTGCAAGGTAATCTTTGGTGTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-S--A--E--E--A--P--E--V--C--Y--D--I--N--L--E--S--Y--R--F--G--H--C--T--R--R--Q--T--A--L--N--N--Q--A--
AGTGCTGAGGAGGCTCCTGAGGTCTGCTATGACATAAATCTTGAAAGTTACCGATTTGGACATTGTACTCGACGACAAACAGCTCTCAACAACCAGGCTT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
C--A--G--I--D--K--F--C--G--R--L--Q--C--T--S--V--T--H--L--P--R--L--Q--E--H--V--S--F--H--H--S--V--T--G
GTGCAGGAATAGATAAGTTTTGTGGAAGACTGCAGTGTACCAGTGTGACCCATCTTCCCCGGCTGCAGGAACATGTTTCATTCCATCACTCAGTGACAGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--G--F--Q--C--F--G--L--D--D--H--R--A--T--D--T--T--D--V--G--C--V--I--D--G--T--P--C--V--H--G--N--F--C-
AGGATTTCAGTGTTTTGGACTGGATGACCACCGTGCAACAGACACAACTGATGTTGGGTGTGTGATAGATGGCACTCCTTGTGTTCATGGAAACTTCTGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-N--N--T--R--C--N--A--T--I--T--S--L--G--Y--D--C--R--P--E--K--C--S--H--R--G--V--C--N--N--R--R--N--C--
AATAACACCAGGTGCAATGCGACTATCACTTCACTGGGCTATGACTGTCGCCCTGAGAAGTGCAGTCATAGAGGGGTGTGCAACAACAGAAGGAACTGCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------------------------------------------->
H--C--H--I--G--W--D--P--P--L--C--L--R--R--G--A--G--G--S--V--D--S--G--P--P--P--K-
ATTGCCATATAGGCTGGGATCCTCCACTGTGCCTAAGAAGAGGTGCTGGTGGGAGTGTCGACAGCGGGCCACCTCCAAAA
                                                                                
--------------------------------------------------------------------------------
--------------------------------------------------------------------------------