Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000168594 (click for geneview)
Transcript ID ENST00000333783(link to ensembl)
Symbol ADAM29
Localtion Chromosome:4:176226864:176273986:1 band: 4q34.1
Description ADAM 29 precursor (A disintegrin and metalloproteinase domain 29). [Source:Uniprot/SWISSPROT;Acc:Q9UKF5]
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--K--M--L--L--L--L--H--C--L--G--V--F--L--S--C--S--G--H--I--Q--D--E--H--P--Q--Y--H--S--P--P--D--V--
ATGAAGATGTTACTCCTGCTGCATTGCCTTGGGGTGTTTCTGTCCTGTTCTGGACACATCCAGGATGAGCACCCCCAATATCACAGCCCTCCGGATGTGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
V--I--P--V--R--I--T--G--T--T--R--G--M--T--P--P--G--W--L--S--Y--I--L--P--F--G--G--Q--K--H--I--I--H--I
TGATTCCTGTGAGGATAACTGGCACCACCAGAGGCATGACACCTCCAGGCTGGCTCTCCTATATCCTGCCCTTTGGAGGCCAGAAACACATTATCCACAT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--K--V--K--K--L--L--F--S--K--H--L--P--V--F--T--Y--T--D--Q--G--A--I--L--E--D--Q--P--F--V--Q--N--N--C-
AAAGGTCAAGAAGCTTTTGTTTTCCAAACACCTCCCTGTGTTCACCTACACAGACCAGGGTGCTATCCTTGAGGACCAGCCATTTGTCCAGAATAACTGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-Y--Y--H--G--Y--V--E--G--D--P--E--S--L--V--S--L--S--T--C--F--G--G--F--Q--G--I--L--Q--I--N--D--F--A--
TACTATCATGGTTATGTGGAAGGGGACCCAGAATCCCTGGTTTCCCTCAGTACCTGTTTTGGGGGTTTTCAAGGAATATTACAGATAAATGACTTTGCTT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
Y--E--I--K--P--L--A--F--S--T--T--F--E--H--L--V--Y--K--M--D--S--E--E--K--Q--F--S--T--M--R--S--G--F--M
ATGAAATCAAGCCCCTAGCATTTTCTACCACGTTTGAACATCTGGTATACAAGATGGACAGTGAGGAGAAACAATTTTCAACCATGAGATCCGGATTTAT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--Q--N--E--I--T--C--R--M--E--F--E--E--I--D--N--S--T--Q--K--Q--S--S--Y--V--G--W--W--I--H--F--R--I--V-
GCAAAATGAAATAACATGCCGAATGGAATTTGAAGAAATTGATAATTCCACTCAGAAGCAAAGTTCTTATGTGGGCTGGTGGATCCATTTTAGGATTGTT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-E--I--V--V--V--I--D--N--Y--L--Y--I--R--Y--E--R--N--D--S--K--L--L--E--D--L--Y--V--I--V--N--I--V--D--
GAAATTGTAGTCGTCATTGATAATTATCTGTACATTCGTTATGAAAGGAACGACTCAAAGTTGCTGGAGGATCTATATGTTATTGTTAATATAGTGGATT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
S--I--L--D--V--I--G--V--K--V--L--L--F--G--L--E--I--W--T--N--K--N--L--I--V--V--D--D--V--R--K--S--V--H
CCATTTTGGATGTCATTGGTGTTAAGGTGTTATTATTTGGTTTGGAGATCTGGACCAATAAAAACCTCATTGTAGTAGATGATGTAAGGAAATCTGTGCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--L--Y--C--K--W--K--S--E--N--I--T--P--R--M--Q--H--D--T--S--H--L--F--T--T--L--G--L--R--G--L--S--G--I-
CCTGTATTGCAAGTGGAAGTCGGAGAACATTACGCCCCGGATGCAACATGACACCTCACATCTTTTCACAACTCTAGGATTAAGAGGGTTAAGTGGCATA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-G--A--F--R--G--M--C--T--P--H--R--S--C--A--I--V--T--F--M--N--K--T--L--G--T--F--S--I--A--V--A--H--H--
GGAGCTTTTAGAGGAATGTGTACACCACACCGTAGTTGTGCAATTGTTACTTTCATGAACAAAACTTTGGGCACTTTTTCAATTGCAGTGGCTCATCATC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
L--G--H--N--L--G--M--N--H--D--E--D--T--C--R--C--S--Q--P--R--C--I--M--H--E--G--N--P--P--I--T--K--F--S
TAGGTCATAATTTGGGCATGAACCATGATGAGGATACATGTCGTTGTTCACAACCTAGATGCATAATGCATGAAGGCAACCCACCAATAACTAAATTTAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--N--C--S--Y--G--D--F--W--E--Y--T--V--E--R--T--K--C--L--L--E--T--V--H--T--K--D--I--F--N--V--K--R--C-
CAATTGTAGTTATGGTGATTTTTGGGAATATACTGTAGAGAGGACAAAGTGTTTGCTTGAAACAGTACACACAAAGGACATCTTTAATGTGAAGCGCTGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-G--N--G--V--V--E--E--G--E--E--C--D--C--G--P--L--K--H--C--A--K--D--P--C--C--L--S--N--C--T--L--T--D--
GGGAATGGTGTTGTTGAAGAAGGAGAAGAGTGTGACTGTGGACCTTTAAAGCATTGTGCAAAAGATCCCTGCTGTCTGTCAAATTGCACTCTGACTGATG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
G--S--T--C--A--F--G--L--C--C--K--D--C--K--F--L--P--S--G--K--V--C--R--K--E--V--N--E--C--D--L--P--E--W
GTTCTACTTGTGCTTTTGGGCTTTGTTGCAAAGACTGCAAGTTCCTACCATCAGGGAAAGTGTGTAGAAAGGAGGTCAATGAATGTGATCTTCCAGAGTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--C--N--G--T--S--H--K--C--P--D--D--F--Y--V--E--D--G--I--P--C--K--E--R--G--Y--C--Y--E--K--S--C--H--D-
GTGCAATGGTACTTCCCATAAGTGCCCAGATGACTTTTATGTGGAAGATGGAATTCCCTGTAAGGAGAGGGGCTACTGCTATGAAAAGAGCTGTCATGAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-R--N--E--Q--C--R--R--I--F--G--A--G--A--N--T--A--S--E--T--C--Y--K--E--L--N--T--L--G--D--R--V--G--H--
CGCAATGAACAGTGTAGGAGGATTTTTGGTGCAGGCGCAAATACTGCAAGTGAGACTTGCTACAAAGAATTGAACACCTTAGGTGACCGTGTTGGTCACT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
C--G--I--K--N--A--T--Y--I--K--C--N--I--S--D--V--Q--C--G--R--I--Q--C--E--N--V--T--E--I--P--N--M--S--D
GTGGTATCAAAAATGCTACATATATAAAGTGTAATATCTCAGATGTCCAGTGTGGAAGAATTCAGTGTGAGAATGTGACAGAAATTCCCAATATGAGTGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--H--T--T--V--H--W--A--R--F--N--D--I--M--C--W--S--T--D--Y--H--L--G--M--K--G--P--D--I--G--E--V--K--D-
TCATACTACTGTGCATTGGGCTCGCTTCAATGACATAATGTGCTGGAGTACTGATTACCATTTGGGGATGAAGGGACCTGATATTGGTGAAGTGAAAGAT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-G--T--E--C--G--I--D--H--I--C--I--H--R--H--C--V--H--I--T--I--L--N--S--N--C--S--P--A--F--C--N--K--R--
GGAACAGAGTGTGGGATAGATCATATATGCATCCACAGGCACTGTGTCCATATAACCATCTTGAATAGTAATTGCTCACCTGCATTTTGTAACAAGAGGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
G--I--C--N--N--K--H--H--C--H--C--N--Y--L--W--D--P--P--N--C--L--I--K--G--Y--G--G--S--V--D--S--G--P--P
GCATCTGCAACAATAAACATCACTGCCATTGCAATTATCTGTGGGACCCTCCCAACTGCCTGATAAAAGGCTATGGAGGTAGTGTTGACAGTGGCCCACC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--P--K--R--K--K--K--K--K--F--C--Y--L--C--I--L--L--L--I--V--L--F--I--L--L--C--C--L--Y--R--L--C--K--K-
CCCTAAGAGAAAGAAGAAAAAGAAGTTCTGTTATCTGTGTATATTGTTGCTTATTGTTTTGTTTATTTTATTATGTTGTCTTTATCGACTTTGTAAAAAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-S--K--P--I--K--K--Q--Q--D--V--Q--T--P--S--A--K--E--E--E--K--I--Q--R--R--P--H--E--L--P--P--Q--S--Q--
AGTAAACCAATAAAAAAGCAGCAAGATGTTCAAACTCCATCTGCAAAAGAAGAGGAAAAAATTCAGCGTCGACCTCATGAGTTACCTCCCCAGAGTCAAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
P--W--V--M--P--S--Q--S--Q--P--P--V--T--P--S--Q--S--H--P--Q--V--M--P--S--Q--S--Q--P--P--V--T--P--S--Q
CTTGGGTGATGCCTTCCCAGAGTCAACCTCCTGTGACGCCTTCCCAGAGTCATCCTCAGGTGATGCCTTCCCAGAGTCAACCTCCTGTGACACCCTCCCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--S--Q--P--R--V--M--P--S--Q--S--Q--P--P--V--M--P--S--Q--S--H--P--Q--L--T--P--S--Q--S--Q--P--P--V--T-
GAGTCAACCTCGGGTGATGCCTTCTCAGAGTCAACCTCCTGTGATGCCTTCCCAGAGTCATCCTCAGTTGACGCCTTCCCAGAGTCAACCTCCTGTGACA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------------------------->
-P--S--Q--R--Q--P--Q--L--M--P--S--Q--S--Q--P--P--V--T--P--S--*-
CCCTCCCAGAGGCAACCTCAGTTGATGCCTTCCCAGAGTCAACCTCCTGTGACGCCCTCCTAG
                                                               
---------------------------------------------------------------
---------------------------------------------------------------