Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000132906 (click for geneview)
Transcript ID ENST00000333868(link to ensembl)
Symbol CASP9
Localtion Chromosome:1:15564103:15596096:-1 band: 1p36.21
Description Caspase-9 precursor (EC 3.4.22.-) (CASP-9) (ICE-like apoptotic protease 6) (ICE-LAP6) (Apoptotic protease Mch-6) (Apoptotic protease activating factor 3) (APAF-3). [Source:Uniprot/SWISSPROT;Acc:P55211]
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--D--E--A--D--R--R--L--L--R--R--C--R--L--R--L--V--E--E--L--Q--V--D--Q--L--W--D--A--L--L--S--R--E--
ATGGACGAAGCGGATCGGCGGCTCCTGCGGCGGTGCCGGCTGCGGCTGGTGGAAGAGCTGCAGGTGGACCAGCTCTGGGACGCCCTGCTGAGCCGCGAGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------><-------------------------------------------------------------------
L--F--R--P--H--M--I--E--D--I--Q--R--A--G--S--G--S--R--R--D--Q--A--R--Q--L--I--I--D--L--E--T--R--G--S
TGTTCAGGCCCCATATGATCGAGGACATCCAGCGGGCAGGCTCTGGATCTCGGCGGGATCAGGCCAGGCAGCTGATCATAGATCTGGAGACTCGAGGGAG
                                :::::::::::.::.:::::  :.::::::::::::::::::::::.::::::.::::::::::::::
--------------------------------CGGGCAGGCTCCGGGTCTCGCAGAGATCAGGCCAGGCAGCTGATCACAGATCTAGAGACTCGAGGGAG
---------------------------------R--A--G--S--G--S--R--R--D--Q--A--R--Q--L--I--T--D--L--E--T--R--G--S

----------------------------------------------------------------------------------------------------
--Q--A--L--P--L--F--I--S--C--L--E--D--T--G--Q--D--M--L--A--S--F--L--R--T--N--R--Q--A--A--K--L--S--K-
TCAGGCTCTTCCTTTGTTCATCTCCTGCTTAGAGGACACAGGCCAGGACATGCTGGCTTCGTTTCTGCGAACTAACAGGCAAGCAGCAAAGTTGTCGAAG
::::::.:::::: :::::::::::::::::::::::::::::::::: :. ::::::::.:: ::: ::::.:..::.::::::.:::::         
TCAGGCCCTTCCTGTGTTCATCTCCTGCTTAGAGGACACAGGCCAGGAAACTCTGGCTTCATTACTGAGAACCAGTAGACAAGCAACAAAG---------
--Q--A--L--P--V--F--I--S--C--L--E--D--T--G--Q--E--T--L--A--S--L--L--R--T--S--R--Q--A--T--K----------

----------------------------------------------------------------------------------------------------
-P--T--L--E--N--L--T--P--V--V--L--R--P--E--I--R--K--P--E--V--L--R--P--E--T--P--R--P--V--D--I--G--S--
CCAACCCTAGAAAACCTTACCCCAGTGGTGCTCAGACCAGAGATTCGCAAACCAGAGGTTCTCAGACCGGAAACACCCAGACCAGTGGACATTGGTTCTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------><---------------------------------><----------------------------------------------
G--G--F--G--D--V--G--A--L--E--S--L--R--G--N--A--D--L--A--Y--I--L--S--M--E--P--C--G--H--C--L--I--I--N
GAGGATTTGGTGATGTCGGTGCTCTTGAGAGTTTGAGGGGAAATGCAGATTTGGCTTACATCCTGAGCATGGAGCCCTGTGGCCACTGCCTCATTATCAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--N--V--N--F--C--R--E--S--G--L--R--T--R--T--G--S--N--I--D--C--E--K--L--R--R--R--F--S--S--L--H--F--M-
CAATGTGAACTTCTGCCGTGAGTCCGGGCTCCGCACCCGCACTGGCTCCAACATCGACTGTGAGAAGTTGCGGCGTCGCTTCTCCTCGCTGCATTTCATG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------><---------------------------------------------------------------------
-V--E--V--K--G--D--L--T--A--K--K--M--V--L--A--L--L--E--L--A--Q--Q--D--H--G--A--L--D--C--C--V--V--V--
GTGGAGGTGAAGGGCGACCTGACTGCCAAGAAAATGGTGCTGGCTTTGCTGGAGCTGGCGCAGCAGGACCACGGTGCTCTGGACTGCTGCGTGGTGGTCA
                                 ::::: : ::::::: ::::::::::::.::.:::::::::.::::::::::::::::::::::::.
---------------------------------ATGGTCCAGGCTTTGGTGGAGCTGGCGCGGCGGGACCACGGCGCTCTGGACTGCTGCGTGGTGGTCG
----------------------------------M--V--Q--A--L--V--E--L--A--R--R--D--H--G--A--L--D--C--C--V--V--V--

-------------------><-------------------------------------------------------------------------------
I--L--S--H--G--C--Q--A--S--H--L--Q--F--P--G--A--V--Y--G--T--D--G--C--P--V--S--V--E--K--I--V--N--I--F
TTCTCTCTCACGGCTGTCAGGCCAGCCACCTGCAGTTCCCAGGGGCTGTCTACGGCACAGATGGATGCCCTGTGTCGGTCGAGAAGATTGTGAACATCTT
: ::::::::::::::::::   :::::::: :::::::::::::::::.::.::::::::::::::.:::::::: :: :::::.::::::::::::::
TGCTCTCTCACGGCTGTCAG---AGCCACCTCCAGTTCCCAGGGGCTGTTTATGGCACAGATGGATGTCCTGTGTCCGTGGAGAAAATTGTGAACATCTT
V--L--S--H--G--C--Q-----S--H--L--Q--F--P--G--A--V--Y--G--T--D--G--C--P--V--S--V--E--K--I--V--N--I--F

-------------------------------------------------------------------><-------------------------------
--N--G--T--S--C--P--S--L--G--G--K--P--K--L--F--F--I--Q--A--C--G--G--E--Q--K--D--H--G--F--E--V--A--S-
CAATGGGACCAGCTGCCCCAGCCTGGGAGGGAAGCCCAAGCTCTTTTTCATCCAGGCCTGTGGTGGGGAGCAGAAAGACCATGGGTTTGAGGTGGCCTCC
:::.::.::::::::::::::::::::::::::::::::::::::.::::::::::::::.::.:::                                 
CAACGGAACCAGCTGCCCCAGCCTGGGAGGGAAGCCCAAGCTCTTCTTCATCCAGGCCTGCGGCGGG---------------------------------
--N--G--T--S--C--P--S--L--G--G--K--P--K--L--F--F--I--Q--A--C--G--G----------------------------------

----------------------------------------------------------------------------------------------------
-T--S--P--E--D--E--S--P--G--S--N--P--E--P--D--A--T--P--F--Q--E--G--L--R--T--F--D--Q--L--D--A--I--S--
ACTTCCCCTGAAGACGAGTCCCCTGGCAGTAACCCCGAGCCAGATGCCACCCCGTTCCAGGAAGGTTTGAGGACCTTCGACCAGCTGGACGCCATATCTA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------------------------><---------------------------------------------------
S--L--P--T--P--S--D--I--F--V--S--Y--S--T--F--P--G--F--V--S--W--R--D--P--K--S--G--S--W--Y--V--E--T--L
GTTTGCCCACACCCAGTGACATCTTTGTGTCCTACTCTACTTTCCCAGGTTTTGTTTCCTGGAGGGACCCCAAGAGTGGCTCCTGGTACGTTGAGACCCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------------------------------><-----------------------------------------
--D--D--I--F--E--Q--W--A--H--S--E--D--L--Q--S--L--L--L--R--V--A--N--A--V--S--V--K--G--I--Y--K--Q--M-
GGACGACATCTTTGAGCAGTGGGCTCACTCTGAAGACCTGCAGTCCCTCCTGCTTAGGGTCGCTAATGCTGTTTCGGTGAAAGGGATTTATAAACAGATG
                                                          ::: :.::::::::.::.::::::::::::::.::.::::: 
----------------------------------------------------------GTCTCCAATGCTGTCTCAGTGAAAGGGATTTACAAGCAGATT
-----------------------------------------------------------V--S--N--A--V--S--V--K--G--I--Y--K--Q--I-

-------------------------------------------------->
-P--G--C--F--N--F--L--R--K--K--L--F--F--K--T--S--*-
CCTGGTTGCTTTAATTTCCTCCGGAAAAAACTTTTCTTTAAAACATCATAA
:::::.::.::::::::::::::::::::.::::::::.::::::: ::.:
CCTGGCTGTTTTAATTTCCTCCGGAAAAAGCTTTTCTTCAAAACATAATGA
-P--G--C--F--N--F--L--R--K--K--L--F--F--K--T--*--*-

Pig Consensus Sequence

>BGISUST0000894501
----------------------------------------------------------------------------------------------------
--------------------------------CGGGCAGGCTCCGGGTCTCGCAGAGATCAGGCCAGGCAGCTGATCACAGATCTAGAGACTCGAGGGAG
TCAGGCCCTTCCTGTGTTCATCTCCTGCTTAGAGGACACAGGCCAGGAAACTCTGGCTTCATTACTGAGAACCAGTAGACAAGCAACAAAG---------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
---------------------------------ATGGTCCAGGCTTTGGTGGAGCTGGCGCGGCGGGACCACGGCGCTCTGGACTGCTGCGTGGTGGTCG
TGCTCTCTCACGGCTGTCAG---AGCCACCTCCAGTTCCCAGGGGCTGTTTATGGCACAGATGGATGTCCTGTGTCCGTGGAGAAAATTGTGAACATCTT
CAACGGAACCAGCTGCCCCAGCCTGGGAGGGAAGCCCAAGCTCTTCTTCATCCAGGCCTGCGGCGGG---------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------GTCTCCAATGCTGTCTCAGTGAAAGGGATTTACAAGCAGATT
CCTGGCTGTTTTAATTTCCTCCGGAAAAAGCTTTTCTTCAAAACATAATGA


>BGISUSP0000894501
--------------------------------------------RAGSGSRRDQARQLITDLETRGSQALPVFISCLEDTGQETLASLLRTSRQATK---
----------------------------------------------------------------------------------------------------
-----------MVQALVELARRDHGALDCCVVVVLSHGCQ-SHLQFPGAVYGTDGCPVSVEKIVNIFNGTSCPSLGGKPKLFFIQACGG-----------
--------------------------------------------------------------------------------------VSNAVSVKGIYKQI
PGCFNFLRKKLFFKT**