Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000187073 (click for geneview)
Transcript ID ENST00000333898(link to ensembl)
Symbol Q86TS2_HUMAN
Localtion Chromosome:14:78277626:78289980:-1 band: 14q24.3
Description Full-length cDNA 5-PRIME end of clone CS0CAP002YE20 of Thymus of Homo sapiens (human).
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--A--S--W--P--V--Q--K--C--C--A--F--R--H--S--C--N--I--L--E--E--D--L--E--V--D--S--C--Q--I--P--L--V--
ATGGCATCTTGGCCTGTCCAAAAATGTTGTGCTTTCAGACATTCTTGCAATATTCTAGAGGAAGATTTGGAAGTAGACAGTTGCCAAATACCATTAGTTT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------------------------------------------------->
S--V--G--S--Q--L--R--K--V--I--L--R--E--S--N--A--R--K--Q--L--A--I--L--T--T--*-
CCGTGGGAAGCCAGCTAAGAAAGGTAATTCTCAGGGAGAGTAATGCGAGGAAACAATTAGCCATTTTGACAACCTGA
                                                                             
-----------------------------------------------------------------------------
-----------------------------------------------------------------------------