Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000186451 (click for geneview)
Transcript ID ENST00000334325(link to ensembl)
Symbol SPATA12
Localtion Chromosome:3:57069509:57084500:1 band: 3p14.3
Description spermatogenesis associated 12 [Source:RefSeq_peptide;Acc:NP_859078]
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--S--S--S--A--L--T--C--G--S--T--L--E--K--S--G--D--T--W--E--M--K--A--L--D--S--S--R--L--V--P--W--P--
ATGTCCAGTTCTGCTCTGACTTGTGGGTCCACCTTAGAAAAGTCAGGAGACACCTGGGAAATGAAGGCACTAGACTCTTCCAGACTCGTTCCATGGCCAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
P--R--G--L--G--S--S--T--Q--H--P--N--K--P--H--C--A--L--A--S--C--Q--G--P--G--V--L--P--G--A--A--S--A--L
CCAGAGGCCTTGGGTCATCCACCCAACATCCCAACAAACCCCACTGTGCACTGGCATCATGCCAGGGTCCAGGTGTCCTGCCAGGAGCAGCCTCTGCCCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--P--E--L--T--F--Q--G--D--V--C--Q--S--E--T--C--Q--R--Y--L--Q--A--A--I--S--L--D--I--A--V--S--Q--I--N-
CCCAGAGCTGACATTTCAGGGGGATGTGTGCCAAAGTGAGACCTGTCAGAGATATTTACAAGCAGCCATCTCTCTTGACATCGCTGTATCCCAAATAAAT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-L--L--G--R--P--S--S--P--P--A--L--L--I--Q--Q--G--S--C--E--Q--V--I--H--N--S--T--P--Q--F--L--G--M--E--
CTTCTGGGAAGACCCTCTTCACCTCCAGCTCTCCTGATACAGCAAGGCAGTTGTGAGCAAGTTATTCATAACTCTACACCTCAATTTCTTGGTATGGAAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
D--G--D--N--E--R--T--T--G--W--L--W--R--L--C--E--D--I--D--A--E--P--S--S--T--G--C--S--R--S--N--Q--L--T
ATGGGGATAATGAGAGGACCACAGGATGGTTGTGGAGACTGTGTGAGGATATAGATGCCGAGCCCAGTAGCACAGGGTGCAGCCGTTCAAACCAACTGAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------------------------------------>
--F--T--E--G--C--F--V--R--S--L--S--T--V--Y--S--N--T--H--I--H--T--H--L--*-
ATTTACTGAGGGCTGCTTTGTCAGGTCCCTCTCTACAGTATACTCCAACACACACATACACACACATCTGTAA
                                                                         
-------------------------------------------------------------------------
-------------------------------------------------------------------------