Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000186215 (click for geneview)
Transcript ID ENST00000334440(link to ensembl)
Symbol Q86SZ3_HUMAN
Localtion Chromosome:14:36060589:36060831:1 band: 14q13.3
Description Full-length cDNA clone CS0DJ013YG01 of T cells (Jurkat cell line) of Homo sapiens (human).
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-F--F--T--R--V--K--K--A--Q--D--T--L--R--P--P--T--C--A--R--V--F--V--R--S--P--R--Q--S--W--G--G--H--P--
TTCTTTACCAGGGTAAAGAAAGCTCAGGACACCCTCCGCCCTCCCACCTGCGCCCGCGTTTTTGTGCGGTCCCCACGGCAGAGCTGGGGAGGCCACCCTA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
T--F--A--Q--G--D--A--L--A--A--G--V--A--K--D--Q--S--E--A--R--L--L--A--L--P--S--Q--G--L--L--W--G--A--L
CGTTTGCGCAGGGAGACGCGCTCGCCGCTGGTGTTGCGAAAGACCAGAGCGAAGCCCGGCTCCTTGCCCTTCCTTCCCAGGGGCTTCTCTGGGGGGCGCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------>
--S--G--P--D--E--L--S--I--D--H--C--G--G--*-
CTCAGGCCCCGACGAACTGAGCATTGATCACTGTGGTGGCTAA
                                           
-------------------------------------------
-------------------------------------------