Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000186978 (click for geneview)
Transcript ID ENST00000335031(link to ensembl)
Localtion Chromosome:4:150630723:151094585:-1 band: 4q31.23
Description  
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<-----------------------------------><--------------------------------------------------------------
-M--T--T--E--E--A--M--P--E--K--A--K--C--P--T--L--E--I--T--K--Q--D--F--F--Q--E--A--K--T--L--I--A--Q--
ATGACTACTGAAGAGGCTATGCCTGAAAAAGCAAAATGTCCTACATTAGAGATCACCAAGCAAGACTTTTTTCAAGAAGCAAAAACTCTCATTGCCCAAC
                                       ::::.:::::::::. ::::::::::.:: ::::::::.:::::::::::::::::.::::
---------------------------------------CCTATATTAGAGATTCCCAAGCAAGATTTGTTTCAAGAGGCAAAAACTCTCATTGCTCAAC
----------------------------------------P--I--L--E--I--P--K--Q--D--L--F--Q--E--A--K--T--L--I--A--Q--

-------------------><-------------------------------------------------------------------------------
H--Y--E--K--I--N--E--N--K--V--Q--G--T--S--I--N--V--F--R--K--K--H--Q--K--P--K--S--G--K--Y--I--P--L--E
ATTATGAGAAAATAAATGAGAATAAAGTTCAAGGTACTTCTATAAATGTTTTTAGAAAGAAACACCAAAAACCGAAATCTGGCAAATACATACCTTTGGA
::::::::::.::::::::::::::::::::::::::: ::::::::::.:::::::: :::::.:::::.:::::::::.::::.: ::::::::::::
ATTATGAGAAGATAAATGAGAATAAAGTTCAAGGTACTGCTATAAATGTCTTTAGAAATAAACATCAAAAGCCGAAATCTAGCAAGTTCATACCTTTGGA
H--Y--E--K--I--N--E--N--K--V--Q--G--T--A--I--N--V--F--R--N--K--H--Q--K--P--K--S--S--K--F--I--P--L--E

----------------------------------------------------------------------------------------------------
--I--D--K--K--V--T--R--D--V--V--Q--E--H--R--A--A--L--R--R--I--C--F--P--K--E--L--S--K--S--E--H--L--Q-
GATTGACAAAAAGGTAACACGTGATGTGGTGCAAGAACATCGGGCCGCACTCAGAAGGATTTGCTTTCCCAAGGAGCTTTCCAAAAGCGAGCATCTTCAG
::::.: ::::..: ::::: ::::::::: ::::::: ::.::: ::.: ::.::.::::::.::::..::.:: : :::::::::.:.::::..::::
GATTAAAAAAAGAGAAACACTTGATGTGGTCCAAGAACTTCAGGCAGCGCACAAAAAGATTTGTTTTCTTAAAGACCATTCCAAAAGTGGGCATTCTCAG
--I--K--K--R--E--T--L--D--V--V--Q--E--L--Q--A--A--H--K--K--I--C--F--L--K--D--H--S--K--S--G--H--S--Q-

------------------------------------------------------------------------------------><--------------
-E--P--P--Q--R--I--S--F--K--E--P--H--I--F--S--R--R--E--R--C--R--P--I--D--L--I--T--K--G--Q--V--K--L--
GAACCCCCACAACGAATCTCCTTCAAGGAACCACACATTTTTAGTAGAAGAGAAAGATGCAGGCCCATAGATCTAATTACAAAAGGACAAGTTAAATTGG
::.::::.:::::::                                                                                     
GAGCCCCTACAACGA-------------------------------------------------------------------------------------
-E--P--L--Q--R--------------------------------------------------------------------------------------

---------------------------------------------------------------------------><-----------------------
D--K--I--M--T--I--I--E--P--V--S--K--K--M--E--T--A--K--Q--Q--H--F--E--E--S--S--N--I--I--S--V--Y--F--S
ATAAAATCATGACTATTATTGAACCAGTGAGTAAAAAAATGGAGACAGCAAAGCAACAGCACTTTGAGGAGTCCAGCAATATAATCAGTGTGTACTTTTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------><--------------------------------------------------------------------------------
--W--I--D--I--V--L--A--L--I--F--L--T--D--K--A--F--Y--D--W--R--G--F--V--L--T--R--S--F--R--L--A--C--D-
CTGGATAGATATTGTTTTAGCATTGATATTTCTAACAGACAAAGCATTCTATGACTGGAGAGGATTTGTGCTGACAAGGTCTTTCCGTTTGGCTTGTGAC
                      ::::::::::::::::: :. :::::::::::.::::::::: ::::::::: :::.:.::.::.:::::::. ::::
----------------------TTGATATTTCTAACAGAGAGTGCATTCTATGATTGGAGAGGAGTTGTGCTGAGAAGATTTTCCCATTTGGCTCCTGAC
-----------------------L--I--F--L--T--E--S--A--F--Y--D--W--R--G--V--V--L--R--R--F--S--H--L--A--P--D-

-----------------------------------------------------><---------------------------------------------
-S--R--R--V--S--F--S--Q--S--S--S--I--F--R--D--Y--Y--S--K--T--F--K--T--L--I--K--K--E--R--Q--P--I--K--
TCCCGTCGAGTTAGTTTCTCTCAATCATCATCAATATTTCGGGATTATTATTCTAAAACCTTTAAAACCCTTATTAAAAAGGAGCGACAACCTATCAAGC
:: .::.:. .:. ::::::: .::::::::::.::::::.:::::::                                                    
TCGTGTTGGCCTGCTTTCTCTAGATCATCATCAGTATTTCAGGATTAT----------------------------------------------------
-S--C--W--P--A--F--S--R--S--S--S--V--F--Q--D--Y-----------------------------------------------------

---------------------><-----------------------------------------------------------------------------
P--E--P--K--S--Q--P--R--I--K--G--T--P--N--K--T--D--K--L--D--S--K--V--K--R--I--G--P--H--I--E--I--F--Q
CAGAACCAAAATCACAACCCAGGATAAAAGGTACTCCAAATAAAACTGATAAACTTGACAGTAAAGTTAAAAGAATTGGACCACACATAGAAATCTTCCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--V--F--R--E--R--K--K--F--M--I--T--P--K--L--I--R--M--V--T--V--M--Q--A--H--V--R--G--W--L--E--R--K--R-
AGTGTTCCGAGAAAGAAAAAAATTCATGATTACCCCAAAATTGATTAGAATGGTCACCGTCATGCAGGCACATGTCAGGGGATGGCTTGAACGGAAAAGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------><------------------------------------------------------------------------------
-L--Q--R--V--M--T--K--A--L--D--H--G--P--D--M--K--A--V--I--N--M--Y--G--R--L--I--H--R--V--R--Y--R--R--
TTGCAAAGAGTAATGACCAAGGCTTTGGATCATGGACCAGATATGAAAGCAGTTATTAACATGTATGGCAGACTAATCCACCGTGTTAGATATCGACGTG
                                             :.::::::::: :::: :::: :::.:::::::.:.:::.:.:.:::::::: ::
---------------------------------------------AGAGCAGTTATAAACAAGTATTGCAAACTAATCTATCGTATCAAATATCGACTTG
----------------------------------------------R--A--V--I--N--K--Y--C--K--L--I--Y--R--I--K--Y--R--L--

-----------------------------------------------------------------><---------------------------------
G--L--W--R--T--R--Q--I--L--N--L--A--E--L--E--E--W--M--D--R--K--K--F--Y--E--I--M--F--A--K--R--E--D--W
GTCTTTGGAGGACAAGACAAATTCTCAACTTAGCAGAGCTAGAGGAGTGGATGGACCGAAAAAAATTCTATGAAATAATGTTTGCTAAGAGGGAAGATTG
::::::::::::::::.:::::  : :::.: ::::::::::::::.::::::::: ::::::::                                   
GTCTTTGGAGGACAAGGCAAATAATAAACCTTGCAGAGCTAGAGGAATGGATGGACAGAAAAAAA-----------------------------------
G--L--W--R--T--R--Q--I--I--N--L--A--E--L--E--E--W--M--D--R--K--K------------------------------------

----------------------------------------------------------------------------------------------------
--P--K--I--E--R--N--E--L--P--N--F--F--S--D--C--G--H--F--P--T--Q--K--Q--V--D--D--T--W--D--L--V--H--Q-
GCCAAAAATTGAAAGAAATGAGCTCCCCAATTTCTTCAGTGACTGTGGTCATTTCCCAACTCAGAAACAAGTTGATGATACTTGGGACCTGGTCCATCAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

><--------------------------------------------------------------------------------------------------
-D--G--K--E--K--Y--S--E--L--I--K--K--S--K--A--I--E--M--L--F--T--L--Y--P--P--E--G--A--H--V--P--D--S--
GATGGCAAAGAAAAATATTCTGAACTAATCAAAAAGTCCAAAGCAATTGAAATGTTATTTACACTCTATCCTCCTGAAGGTGCACATGTGCCTGACAGTA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------------------><------------------------------------
T--L--L--K--S--T--W--L--R--P--I--V--N--G--E--E--G--Y--R--Y--I--V--N--G--H--P--A--L--K--R--A--N--I--R
CACTACTCAAGTCGACTTGGTTGAGACCCATAGTAAATGGGGAAGAAGGTTATAGATATATAGTAAATGGACATCCAGCACTCAAACGAGCTAACATCCG
                                                                 ::::::::::::..::::::: :::::::::::::
-----------------------------------------------------------------AATGGACATCCAATACTCAAAAGAGCTAACATCCG
------------------------------------------------------------------N--G--H--P--I--L--K--R--A--N--I--R

--------------------------------------------------------------->
--V--V--G--K--L--V--A--R--S--I--R--E--R--K--M--R--Q--H--Y--K--S-
GGTTGTTGGAAAGTTGGTGGCCCGATCCATAAGAGAAAGGAAAATGAGACAACATTATAAGTCA
:.:::::::::::::.:::::: ::::.::.:::::::::::::::::::::: ::::  .:::
GATTGTTGGAAAGTTAGTGGCCAGATCTATGAGAGAAAGGAAAATGAGACAACTTTATTTATCA
--I--V--G--K--L--V--A--R--S--M--R--E--R--K--M--R--Q--L--Y--L--S-

Pig Consensus Sequence

>BGISUST0000895096
---------------------------------------CCTATATTAGAGATTCCCAAGCAAGATTTGTTTCAAGAGGCAAAAACTCTCATTGCTCAAC
ATTATGAGAAGATAAATGAGAATAAAGTTCAAGGTACTGCTATAAATGTCTTTAGAAATAAACATCAAAAGCCGAAATCTAGCAAGTTCATACCTTTGGA
GATTAAAAAAAGAGAAACACTTGATGTGGTCCAAGAACTTCAGGCAGCGCACAAAAAGATTTGTTTTCTTAAAGACCATTCCAAAAGTGGGCATTCTCAG
GAGCCCCTACAACGA-------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------TTGATATTTCTAACAGAGAGTGCATTCTATGATTGGAGAGGAGTTGTGCTGAGAAGATTTTCCCATTTGGCTCCTGAC
TCGTGTTGGCCTGCTTTCTCTAGATCATCATCAGTATTTCAGGATTAT----------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
---------------------------------------------AGAGCAGTTATAAACAAGTATTGCAAACTAATCTATCGTATCAAATATCGACTTG
GTCTTTGGAGGACAAGGCAAATAATAAACCTTGCAGAGCTAGAGGAATGGATGGACAGAAAAAAA-----------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
-----------------------------------------------------------------AATGGACATCCAATACTCAAAAGAGCTAACATCCG
GATTGTTGGAAAGTTAGTGGCCAGATCTATGAGAGAAAGGAAAATGAGACAACTTTATTTATCA


>BGISUSP0000895096
-------------PILEIPKQDLFQEAKTLIAQHYEKINENKVQGTAINVFRNKHQKPKSSKFIPLEIKKRETLDVVQELQAAHKKICFLKDHSKSGHSQ
EPLQR---------------------------------------------------------------------LIFLTESAFYDWRGVVLRRFSHLAPD
SCWPAFSRSSSVFQDY------------------------------------------------------------------------------------
---------------RAVINKYCKLIYRIKYRLGLWRTRQIINLAELEEWMDRKK---------------------------------------------
-------------------------------------------------------NGHPILKRANIRIVGKLVARSMRERKMRQLYLS