Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000120519 (click for geneview)
Transcript ID ENST00000335472(link to ensembl)
Symbol Q8NBP8_HUMAN
Localtion Chromosome:4:147532742:147788755:-1 band: 4q31.22
Description  
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<-------------------------------------------------------><-------------------------------------><---
-M--P--P--P--V--S--S--A--V--I--L--T--K--A--V--G--G--N--E--A--A--A--I--F--N--S--A--F--G--S--F--L--G--
ATGCCTCCGCCTGTGTCTTCTGCAGTGATTTTAACCAAGGCAGTTGGTGGAAATGAGGCAGCTGCAATATTTAATTCAGCCTTTGGAAGTTTTTTGGGCA
:::::::: :::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::.:::::::::::::::    
ATGCCTCCCCCTGTGTCTTCTGCAGTGATTTTAACCAAGGCAGTTGGTGGAAATGAGGCAGCTGCAATATTTAATTCAGCTTTTGGAAGTTTTTTG----
-M--P--P--P--V--S--S--A--V--I--L--T--K--A--V--G--G--N--E--A--A--A--I--F--N--S--A--F--G--S--F--L-----

-------------------------------><-------------------------------------------------------------------
I--V--I--T--P--L--L--L--L--L--F--L--G--S--S--S--S--V--P--F--T--S--I--F--S--Q--L--F--M--T--V--V--V--P
TCGTTATAACACCCCTGCTCCTGCTGCTTTTTCTTGGTTCATCTTCTTCTGTGCCTTTCACATCTATTTTTTCTCAGCTTTTTATGACTGTTGTGGTTCC
                                :::::.:::::.::::::::::::::.:::::::::::::::::::::::::::::::::::::::::
--------------------------------CTTGGCTCATCCTCTTCTGTGCCTTTTACATCTATTTTTTCTCAGCTTTTTATGACTGTTGTGGTTCC
---------------------------------L--G--S--S--S--S--V--P--F--T--S--I--F--S--Q--L--F--M--T--V--V--V--P

---------------><-----------------------------------------------------------------------------------
--L--I--I--G--Q--I--V--R--R--Y--I--K--D--W--L--E--R--K--K--P--P--F--G--A--I--S--S--S--V--L--L--M--I-
TCTCATCATTGGACAGATTGTCCGAAGATACATCAAGGATTGGCTTGAGAGAAAGAAGCCTCCTTTTGGTGCTATCAGCAGCAGTGTACTCCTCATGATC
::::::.:::::::::::::::::.::.::::::::::::::::::::.::::.:::.:::::::::::::::.::::::::::.::.::::::::::::
TCTCATTATTGGACAGATTGTCCGGAGGTACATCAAGGATTGGCTTGAAAGAAGGAAACCTCCTTTTGGTGCTGTCAGCAGCAGCGTGCTCCTCATGATC
--L--I--I--G--Q--I--V--R--R--Y--I--K--D--W--L--E--R--R--K--P--P--F--G--A--V--S--S--S--V--L--L--M--I-

---------------------------------------------------------------------------------><-----------------
-I--Y--T--T--F--C--D--T--F--S--N--P--N--I--D--L--D--K--F--S--L--V--L--I--L--F--I--I--F--S--I--Q--L--
ATCTACACAACATTCTGTGACACGTTCTCTAACCCAAATATTGACCTGGATAAATTCAGCCTTGTTCTCATACTGTTCATAATATTTTCTATCCAGCTGA
::::::::::: ::::::::::::::::: ::::::::: :::::                                       : .:::::.:::::::
ATCTACACAACCTTCTGTGACACGTTCTCGAACCCAAATTTTGAC---------------------------------------TGCTCTATTCAGCTGA
-I--Y--T--T--F--C--D--T--F--S--N--P--N--F--D-----------------------------------------C--S--I--Q--L--

---------------------------------><-----------------------------------------------------------------
S--F--M--L--L--T--F--I--F--S--T--R--N--N--S--G--F--T--P--A--D--T--V--A--I--I--F--C--S--T--H--K--S--L
GTTTTATGCTTTTAACTTTCATCTTTTCAACAAGGAATAATTCGGGTTTCACACCAGCAGACACAGTGGCTATCATTTTCTGTTCTACACACAAATCCCT
::::::::::::::::.:::::::::::::::   ::::::::::::::::::::::::::::: ::::::::::: ::::::::::::::::::::.::
GTTTTATGCTTTTAACCTTCATCTTTTCAACA---AATAATTCGGGTTTCACACCAGCAGACACCGTGGCTATCATGTTCTGTTCTACACACAAATCTCT
S--F--M--L--L--T--F--I--F--S--T-----N--N--S--G--F--T--P--A--D--T--V--A--I--M--F--C--S--T--H--K--S--L

-------><-------------------------------------------------------------------------------------------
--T--L--G--I--P--M--L--K--I--V--F--A--G--H--E--H--L--S--L--I--S--V--P--L--L--I--Y--H--P--A--Q--I--L-
TACATTGGGAATTCCGATGCTGAAGATCGTGTTTGCAGGCCATGAGCATCTCTCTTTAATATCTGTACCCTTGCTCATCTACCACCCAGCTCAGATCCTT
.:::.::   :::::.:::::::::::::::::::: :::::::::::.::::::::::::::.:: :::.::::.:::::::::::.:. :::::::::
CACACTG---ATTCCAATGCTGAAGATCGTGTTTGCCGGCCATGAGCACCTCTCTTTAATATCCGTCCCCCTGCTTATCTACCACCCGGTGCAGATCCTT
--T--L-----I--P--M--L--K--I--V--F--A--G--H--E--H--L--S--L--I--S--V--P--L--L--I--Y--H--P--V--Q--I--L-

-----------------------------------------------------><---------------------------->
-L--G--S--V--L--V--P--T--I--K--S--W--M--V--S--R--Q--K--G--V--K--L--T--R--P--T--V--*-
CTGGGAAGTGTGTTGGTGCCAACAATCAAGTCTTGGATGGTATCAAGGCAGAAGGGAGTGAAGCTGACAAGGCCGACAGTATAA
:::::::::::::::::::::::.:: ::.:::::::::                                             
CTGGGAAGTGTGTTGGTGCCAACGATAAAATCTTGGATG---------------------------------------------
-L--G--S--V--L--V--P--T--I--K--S--W--M----------------------------------------------

Pig Consensus Sequence

>BGISUST0000900545
ATGCCTCCCCCTGTGTCTTCTGCAGTGATTTTAACCAAGGCAGTTGGTGGAAATGAGGCAGCTGCAATATTTAATTCAGCTTTTGGAAGTTTTTTG----
--------------------------------CTTGGCTCATCCTCTTCTGTGCCTTTTACATCTATTTTTTCTCAGCTTTTTATGACTGTTGTGGTTCC
TCTCATTATTGGACAGATTGTCCGGAGGTACATCAAGGATTGGCTTGAAAGAAGGAAACCTCCTTTTGGTGCTGTCAGCAGCAGCGTGCTCCTCATGATC
ATCTACACAACCTTCTGTGACACGTTCTCGAACCCAAATTTTGAC---------------------------------------TGCTCTATTCAGCTGA
GTTTTATGCTTTTAACCTTCATCTTTTCAACA---AATAATTCGGGTTTCACACCAGCAGACACCGTGGCTATCATGTTCTGTTCTACACACAAATCTCT
CACACTG---ATTCCAATGCTGAAGATCGTGTTTGCCGGCCATGAGCACCTCTCTTTAATATCCGTCCCCCTGCTTATCTACCACCCGGTGCAGATCCTT
CTGGGAAGTGTGTTGGTGCCAACGATAAAATCTTGGATG---------------------------------------------


>BGISUSP0000900545
MPPPVSSAVILTKAVGGNEAAAIFNSAFGSFL------------LGSSSSVPFTSIFSQLFMTVVVPLIIGQIVRRYIKDWLERRKPPFGAVSSSVLLMI
IYTTFCDTFSNPNFD-------------CSIQLSFMLLTFIFST-NNSGFTPADTVAIMFCSTHKSLTL-IPMLKIVFAGHEHLSLISVPLLIYHPVQIL
LGSVLVPTIKSWM---------------