Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000168775 (click for geneview)
Transcript ID ENST00000335767(link to ensembl)
Symbol KCRU_HUMAN
Localtion Chromosome:15:41673546:41678874:1 band: 15q15.3
Description Creatine kinase, ubiquitous mitochondrial precursor (EC 2.7.3.2) (U- MtCK) (Mia-CK) (Acidic-type mitochondrial creatine kinase). [Source:Uniprot/SWISSPROT;Acc:P12532]
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--A--G--P--F--S--R--L--L--S--A--R--P--G--L--R--L--L--A--L--A--G--A--G--S--L--A--A--G--F--L--L--R--
ATGGCTGGTCCCTTCTCCCGTCTGCTGTCCGCCCGCCCGGGACTCAGGCTCCTGGCTTTGGCCGGAGCGGGGTCTCTAGCCGCTGGGTTTCTGCTCCGAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------------><--------------------------------------------------
P--E--P--V--R--A--A--S--E--R--R--R--L--Y--P--P--S--A--E--Y--P--D--L--R--K--H--N--N--C--M--A--S--H--L
CGGAACCTGTACGAGCTGCCAGTGAACGACGGAGGCTGTATCCCCCGAGCGCTGAGTACCCAGACCTCCGAAAGCACAACAACTGCATGGCCAGTCACCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--T--P--A--V--Y--A--R--L--C--D--K--T--T--P--T--G--W--T--L--D--Q--C--I--Q--T--G--V--D--N--P--G--H--P-
GACCCCAGCAGTCTATGCACGGCTCTGCGACAAGACCACACCCACTGGTTGGACGCTAGATCAGTGTATCCAGACTGGCGTGGACAACCCTGGCCACCCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------------------------><---------------------------------------------------
-F--I--K--T--V--G--M--V--A--G--D--E--E--T--Y--E--V--F--A--D--L--F--D--P--V--I--Q--E--R--H--N--G--Y--
TTCATCAAGACTGTGGGCATGGTGGCTGGAGATGAGGAGACCTATGAGGTATTTGCTGACCTGTTTGACCCTGTGATCCAAGAGCGACACAATGGATATG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------><-------------------------------------------------------
D--P--R--T--M--K--H--T--T--D--L--D--A--S--K--I--R--S--G--Y--F--D--E--R--Y--V--L--S--S--R--V--R--T--G
ACCCCCGGACAATGAAGCACACCACGGATCTAGATGCCAGTAAAATCCGTTCTGGCTACTTTGATGAGAGGTATGTATTGTCCTCTAGAGTCAGAACTGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--R--S--I--R--G--L--S--L--P--P--A--C--T--R--A--E--R--R--E--V--E--R--V--V--V--D--A--L--S--G--L--K--G-
CCGAAGCATCCGAGGACTCAGTCTGCCTCCAGCTTGCACTCGAGCAGAGCGACGAGAGGTGGAACGTGTTGTGGTGGATGCACTGAGTGGCCTGAAGGGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------------------------------------------><---------------------------------
-D--L--A--G--R--Y--Y--R--L--S--E--M--T--E--A--E--Q--Q--Q--L--I--D--D--H--F--L--F--D--K--P--V--S--P--
GACCTGGCTGGACGTTACTATAGGCTCAGTGAGATGACAGAGGCTGAACAGCAGCAGCTTATTGATGACCACTTTCTGTTTGATAAGCCTGTGTCCCCGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------------------------><-----------------------------------------------
L--L--T--A--A--G--M--A--R--D--W--P--D--A--R--G--I--W--H--N--N--E--K--S--F--L--I--W--V--N--E--E--D--H
TGCTGACTGCAGCAGGAATGGCTCGAGACTGGCCAGATGCTCGTGGAATTTGGCACAACAATGAGAAGAGCTTCCTGATCTGGGTGAATGAGGAGGATCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------------------------------------------------><-----------------------
--T--R--V--I--S--M--E--K--G--G--N--M--K--R--V--F--E--R--F--C--R--G--L--K--E--V--E--R--L--I--Q--E--R-
TACACGGGTGATCTCCATGGAGAAGGGTGGTAACATGAAGAGAGTGTTTGAAAGATTCTGCCGAGGCCTCAAAGAGGTGGAGAGACTTATCCAAGAACGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-G--W--E--F--M--W--N--E--R--L--G--Y--I--L--T--C--P--S--N--L--G--T--G--L--R--A--G--V--H--I--K--L--P--
GGCTGGGAGTTCATGTGGAATGAGCGTTTGGGATACATCTTGACCTGTCCATCTAACCTGGGCACTGGACTTCGGGCAGGAGTGCACATCAAACTGCCCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------><----------------------------------------------------------------------------------------
L--L--S--K--D--S--R--F--P--K--I--L--E--N--L--R--L--Q--K--R--G--T--G--G--V--D--T--A--A--T--G--G--V--F
TGCTAAGCAAAGATAGCCGCTTCCCAAAGATCCTGGAGAACCTAAGACTCCAAAAACGTGGTACTGGAGGAGTGGACACTGCTGCTACAGGCGGTGTCTT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------><--------------------------------------------------------------
--D--I--S--N--L--D--R--L--G--K--S--E--V--E--L--V--Q--L--V--I--D--G--V--N--Y--L--I--D--C--E--R--R--L-
TGATATTTCTAATTTGGACCGACTAGGCAAATCAGAGGTGGAGCTGGTGCAACTGGTCATCGATGGAGTAAACTATTTGATTGATTGTGAACGGCGTCTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------->
-E--R--G--Q--D--I--R--I--P--T--P--V--I--H--T--K--H--*-
GAGAGAGGCCAGGATATCCGCATCCCCACACCTGTCATCCACACCAAGCATTAA
                                                      
------------------------------------------------------
------------------------------------------------------