Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000137747 (click for geneview)
Transcript ID ENST00000336500(link to ensembl)
Symbol TMPSD_HUMAN
Localtion Chromosome:11:117278970:117305306:-1 band: 11q23.3
Description Membrane-type mosaic serine protease.
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<-------------------><------------------------------------------------------------------------------
-M--E--R--D--S--H--G--N--A--S--P--A--R--T--P--S--A--G--A--S--P--A--Q--A--S--P--A--G--T--P--P--G--R--
ATGGAGAGGGACAGCCACGGGAATGCATCTCCAGCAAGAACACCTTCAGCTGGAGCATCTCCAGCCCAGGCATCTCCAGCTGGGACACCTCCAGGCCGGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
A--S--P--A--Q--A--S--P--A--Q--A--S--P--A--G--T--P--P--G--R--A--S--P--A--Q--A--S--P--A--G--T--P--P--G
CATCTCCAGCCCAGGCATCTCCAGCCCAGGCATCTCCAGCTGGGACACCTCCGGGCCGGGCATCTCCAGCCCAGGCATCTCCAGCTGGTACACCTCCAGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--R--A--S--P--G--R--A--S--P--A--Q--A--S--P--A--Q--A--S--P--A--R--A--S--P--A--L--A--S--L--S--R--S--S-
CCGGGCATCTCCAGGCCGGGCATCTCCAGCCCAGGCATCTCCAGCCCAGGCATCTCCAGCCCGGGCATCTCCGGCTCTGGCATCACTTTCCAGGTCCTCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-S--G--R--S--S--S--A--R--S--A--S--V--T--T--S--P--T--R--V--Y--L--V--R--A--T--P--V--G--A--V--P--I--R--
TCCGGCAGGTCATCATCCGCCAGGTCAGCCTCGGTGACAACCTCCCCAACCAGAGTGTACCTTGTTAGAGCAACACCAGTGGGGGCTGTACCCATCCGAT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------><------------------------------------------------
S--S--P--A--R--S--A--P--A--T--R--A--T--R--E--S--P--G--T--S--L--P--K--F--T--W--R--E--G--Q--K--Q--L--P
CATCTCCTGCCAGGTCAGCACCAGCAACCAGGGCCACCAGGGAGAGCCCAGGTACGAGCCTGCCCAAGTTCACCTGGCGGGAGGGCCAGAAGCAGCTACC
                                                      . :::.::::::::::::::::::.:::::::::.:::   ::.::
-----------------------------------------------------CTCAGCTTGCCCAAGTTCACCTGGCAGGAGGGCCAAAAG---CTGCC
------------------------------------------------------L--S--L--P--K--F--T--W--Q--E--G--Q--K-----L--P

-------------------------------------------------------><-------------------------------------------
--L--I--G--C--V--L--L--L--I--A--L--V--V--S--L--I--I--L--F--Q--F--W--Q--G--H--T--G--I--R--Y--K--E--Q-
GCTCATCGGGTGCGTGCTCCTCCTCATTGCCCTGGTGGTTTCGCTCATCATCCTCTTCCAGTTCTGGCAGGGCCACACAGGGATCAGGTACAAGGAGCAG
:::::::::.::..: :::::::::::.:::                                                                     
GCTCATCGGATGTATCCTCCTCCTCATCGCC---------------------------------------------------------------------
--L--I--G--C--I--L--L--L--I--A----------------------------------------------------------------------

------------------------------------------------------------------------------><--------------------
-R--E--S--C--P--K--H--A--V--R--C--D--G--V--V--D--C--K--L--K--S--D--E--L--G--C--V--R--F--D--W--D--K--
AGGGAGAGCTGTCCCAAGCACGCTGTTCGCTGTGACGGGGTGGTGGACTGCAAGCTGAAGAGTGACGAGCTGGGCTGCGTGAGGTTTGACTGGGACAAGT
                                                                                 ::::::::::::::::.::
---------------------------------------------------------------------------------AGGTTTGACTGGGACAGGT
----------------------------------------------------------------------------------R--F--D--W--D--R--

----------------------------------------------------------------------------------------------------
S--L--L--K--I--Y--S--G--S--S--H--Q--W--L--P--I--C--S--S--N--W--N--D--S--Y--S--E--K--T--C--Q--Q--L--G
CTCTGCTTAAAATCTACTCTGGGTCCTCCCATCAGTGGCTTCCCATCTGTAGCAGCAACTGGAATGACTCCTACTCAGAGAAGACCTGCCAGCAGCTGGG
:::::::::::.::::::::::.::::::::: :::::::::::.::::.::...::  :::::.:::                                
CTCTGCTTAAAGTCTACTCTGGATCCTCCCATAAGTGGCTTCCCGTCTGCAGTGACAC-TGGAACGAC--------------------------------
S--L--L--K--V--Y--S--G--S--S--H--K--W--L--P--V--C--S--D--N--W--N--D---------------------------------

-----------><---------------------------------------------------------------------------------------
--F--E--S--A--H--R--T--T--E--V--A--H--R--D--F--A--N--S--F--S--I--L--R--Y--N--S--T--I--Q--E--S--L--H-
TTTCGAGAGTGCTCACCGGACAACCGAGGTTGCCCACAGGGATTTTGCCAACAGCTTCTCAATCTTGAGATACAACTCCACCATCCAGGAAAGCCTCCAC
          :::.:::::::::::.:::: ::. :::::::::::::::.:::.::::::::::. ..:::.:::::::::::::::::.::: ::.::
----------GCTTACCGGACAACCAAGGTGGCTGACAGGGATTTTGCCAGCAGTTTCTCAATCTCTGAATATAACTCCACCATCCAGGAGAGCATCTAC
-----------A--Y--R--T--T--K--V--A--D--R--D--F--A--S--S--F--S--I--S--E--Y--N--S--T--I--Q--E--S--I--Y-

----><------------------------------------------><--------------------------------------------------
-R--S--E--C--P--S--Q--R--Y--I--S--L--Q--C--S--H--C--G--L--R--A--M--T--G--R--I--V--G--G--A--L--A--S--
AGGTCTGAATGCCCTTCCCAGCGGTATATCTCTCTCCAGTGTTCCCACTGCGGACTGAGGGCCATGACCGGGCGGATCGTGGGAGGGGCGCTGGCCTCGG
                                                                                             :::.:.:
---------------------------------------------------------------------------------------------GCCCCAG
----------------------------------------------------------------------------------------------A--P--

----------------------------------------------------------------------------------------------------
D--S--K--W--P--W--Q--V--S--L--H--F--G--T--T--H--I--C--G--G--T--L--I--D--A--Q--W--V--L--T--A--A--H--C
ATAGCAAGTGGCCTTGGCAAGTGAGTCTGCACTTCGGCACCACCCACATCTGTGGAGGCACGCTCATTGACGCCCAGTGGGTGCTCACTGCCGCCCACTG
: :::::::::::::::::::: ::.::::: :::::::::::::::::.:::::.: ::: :: ::.:::::::::::::: ::::::::.::::::::
AGAGCAAGTGGCCTTGGCAAGTTAGCCTGCAGTTCGGCACCACCCACATTTGTGGGGTCACCCTGATCGACGCCCAGTGGGTCCTCACTGCTGCCCACTG
E--S--K--W--P--W--Q--V--S--L--Q--F--G--T--T--H--I--C--G--V--T--L--I--D--A--Q--W--V--L--T--A--A--H--C

-----------><---------------------------------------------------------------------------------------
--F--F--V--T--R--E--K--V--L--E--G--W--K--V--Y--A--G--T--S--N--L--H--Q--L--P--E--A--A--S--I--A--E--I-
CTTCTTCGTGACCCGGGAGAAGGTCCTGGAGGGCTGGAAGGTGTACGCGGGCACCAGCAACCTGCACCAGTTGCCTGAGGCAGCCTCCATTGCCGAGATC
:::.                                                                                                
CTTT------------------------------------------------------------------------------------------------
--F-------------------------------------------------------------------------------------------------

------------------------------------------------------------------------------------><--------------
-I--I--N--S--N--Y--T--D--E--E--D--D--Y--D--I--A--L--M--R--L--S--K--P--L--T--L--S--A--H--I--H--P--A--
ATCATCAACAGCAATTACACCGATGAGGAGGACGACTATGACATCGCCCTCATGCGGCTGTCCAAGCCCCTGACCCTGTCCGCTCACATCCACCCTGCTT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------------------------------------------------------------><---------------
C--L--P--M--H--G--Q--T--F--S--L--N--E--T--C--W--I--T--G--F--G--K--T--R--E--T--D--D--K--T--S--P--F--L
GCCTCCCCATGCATGGACAGACCTTTAGCCTCAATGAGACCTGCTGGATCACAGGCTTTGGCAAGACCAGGGAGACAGATGACAAGACATCCCCCTTCCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--R--E--V--Q--V--N--L--I--D--F--K--K--C--N--D--Y--L--V--Y--D--S--Y--L--T--P--R--M--M--C--A--G--D--L-
CCGGGAGGTGCAGGTCAATCTCATCGACTTCAAGAAATGCAATGACTACTTGGTCTATGACAGTTACCTTACCCCAAGGATGATGTGTGCTGGGGACCTT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------><------------------------------------------------------------------------
-R--G--G--R--D--S--C--Q--G--D--S--G--G--P--L--V--C--E--Q--N--N--R--W--Y--L--A--G--V--T--S--W--G--T--
CGTGGGGGCAGAGACTCCTGCCAGGGAGACAGCGGGGGGCCTCTTGTCTGTGAGCAGAACAACCGCTGGTACCTGGCAGGTGTCACCAGCTGGGGCACAG
                        :: ::::::::::::::.:: :::::.::::::::::::::::::::::::.:::: :::::::::::::::::.:
------------------------GGTGACAGCGGGGGGCCCCTGGTCTGCGAGCAGAACAACCGCTGGTACCTGACAGGAGTCACCAGCTGGGGCACGG
-------------------------G--D--S--G--G--P--L--V--C--E--Q--N--N--R--W--Y--L--T--G--V--T--S--W--G--T--

----------------------------------------------------------------------------------------------------
G--C--G--Q--R--N--K--P--G--V--Y--T--K--V--T--E--V--L--P--W--I--Y--S--K--M--E--V--R--S--L--Q--Q--D--T
GCTGTGGCCAGAGAAACAAACCTGGTGTGTACACCAAAGTGACAGAAGTTCTTCCCTGGATTTACAGCAAGATGGAGGTAAGATCCCTGCAGCAGGACAC
::::::::::::::::::::::.::.:::::::::::::::::.::::: ::.::::::::.:::::::::::::::::.                    
GCTGTGGCCAGAGAAACAAACCCGGCGTGTACACCAAAGTGACGGAAGTGCTCCCCTGGATCTACAGCAAGATGGAGGTG--------------------
G--C--G--Q--R--N--K--P--G--V--Y--T--K--V--T--E--V--L--P--W--I--Y--S--K--M--E--V---------------------

-------------------------------------------------------------
--A--P--S--R--L--G--T--S--S--G--G--D--P--G--G--A--P--R--L--*-
TGCACCCAGCAGGCTGGGAACTTCCTCAGGTGGGGACCCTGGAGGAGCACCCAGGTTGTAG
                                                             
-------------------------------------------------------------
-------------------------------------------------------------

Pig Consensus Sequence

>BGISUST0000891960
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
-----------------------------------------------------CTCAGCTTGCCCAAGTTCACCTGGCAGGAGGGCCAAAAGCTGCCGCT
CATCGGATGTATCCTCCTCCTCATCGCC------------------------------------------------------------------------
------------------------------------------------------------------------------AGGTTTGACTGGGACAGGTCTC
TGCTTAAAGTCTACTCTGGATCCTCCCATAAGTGGCTTCCCGTCTGCAGTGActGGAACGAC--------------------------------------
----GCTTACCGGACAACCAAGGTGGCTGACAGGGATTTTGCCAGCAGTTTCTCAATCTCTGAATATAACTCCACCATCCAGGAGAGCATCTAC------
---------------------------------------------------------------------------------------GCCCCAGAGAGCA
AGTGGCCTTGGCAAGTTAGCCTGCAGTTCGGCACCACCCACATTTGTGGGGTCACCCTGATCGACGCCCAGTGGGTCCTCACTGCTGCCCACTGCTTT--
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
------------------GGTGACAGCGGGGGGCCCCTGGTCTGCGAGCAGAACAACCGCTGGTACCTGACAGGAGTCACCAGCTGGGGCACGGGCTGTG
GCCAGAGAAACAAACCCGGCGTGTACACCAAAGTGACGGAAGTGCTCCCCTGGATCTACAGCAAGATGGAGGTG--------------------------
-------------------------------------------------------


>BGISUSP0000891960
----------------------------------------------------------------------------------------------------
---------------------------------------------------LSLPKFTWQEGQKLPLIGCILLLIA------------------------
--------------------------RFDWDRSLLKVYSGSSHKWLPVCSDWND--------------AYRTTKVADRDFASSFSISEYNSTIQESIY--
-----------------------------APESKWPWQVSLQFGTTHICGVTLIDAQWVLTAAHCF----------------------------------
----------------------------------------------------------------------------------------------------
------GDSGGPLVCEQNNRWYLTGVTSWGTGCGQRNKPGVYTKVTEVLPWIYSKMEV---------------------------