Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000096682 (click for geneview)
Transcript ID ENST00000336835(link to ensembl)
Symbol G8_HUMAN
Localtion Chromosome:6:31910672:31915513:1 band: 6p21.33
Description G8 protein. [Source:Uniprot/SWISSPROT;Acc:Q9UBA6]
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<-------------------------------------------------------------------------------------><------------
-M--R--V--V--M--A--R--L--L--S--E--G--E--Q--G--I--P--T--A--C--A--A--F--A--Q--Q--P--A--G--P--R--R--G--
ATGAGAGTTGTAATGGCCCGACTGTTGAGTGAGGGGGAGCAGGGGATCCCAACGGCTTGCGCTGCCTTTGCGCAGCAGCCGGCGGGCCCACGTCGCGGCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
L--A--G--V--G--E--G--G--P--Q--C--S--W--V--N--Y--R--C--T--L--E--F--L--V--S--L--L--G--T--D--L--A--R--G
TGGCTGGGGTAGGAGAGGGCGGTCCCCAGTGCAGTTGGGTGAACTACCGTTGCACACTGGAGTTTCTGGTGTCTTTGCTTGGAACTGACCTAGCTCGTGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------><------------------------------------------------
--R--G--N--S--A--S--G--P--T--A--P--A--D--S--K--Q--L--M--N--S--G--S--P--A--R--D--N--A--P--S--Q--R--F-
CAGGGGGAACTCGGCTAGCGGCCCCACAGCCCCTGCTGACTCAAAACAACTAATGAACTCTGGAAGCCCAGCCAGGGACAATGCACCTTCACAGAGATTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------->
-C--T--N--L--S--E--G--L--R--F--G--I--S--P--S--W--R--E--A--L--Y--G--C--H--A--*-
TGCACTAATCTGAGTGAAGGTCTAAGGTTTGGAATCTCCCCCTCATGGAGAGAAGCTTTGTATGGCTGTCATGCTTAG
                                                                              
------------------------------------------------------------------------------
------------------------------------------------------------------------------