Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000167540 (click for geneview)
Transcript ID ENST00000337244(link to ensembl)
Symbol AFG3L1
Localtion Chromosome:16:88566495:88590519:1 band: 16q24.3
Description AFG3-like protein 1 (EC 3.4.24.-) (Fragment). [Source:Uniprot/SWISSPROT;Acc:O43931]
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<--------------------------------------------------------------------------------------><-----------
-V--V--V--L--A--G--T--N--R--P--D--V--L--D--P--A--L--M--R--P--G--R--F--H--R--Q--I--Y--T--G--P--P--Y--
GTCGTGGTGTTGGCTGGCACCAACCGCCCTGACGTCCTGGACCCGGCCCTCATGCGGCCTGGCCGGTTTCATCGCCAGATTTACACTGGTCCCCCTTACA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
I--K--G--R--S--S--I--F--K--V--H--L--R--P--L--K--L--D--K--S--L--N--K--D--T--L--A--R--K--L--A--V--L--T
TTAAAGGCAGGTCCTCCATCTTTAAGGTCCACCTGCGCCCACTGAAGCTGGACAAGAGCCTCAATAAGGACACCCTGGCGAGGAAGCTGGCAGTGCTCAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------><-------------------------------------------------------------------------------------
--P--G--F--P--D--V--C--L--H--T--K--V--K--K--L--E--C--Y--Q--D--C--F--L--L--P--I--D--G--D--D--S--A--L-
CCCAGGCTTCCCTGATGTCTGTTTACATACCAAAGTTAAAAAGCTGGAATGTTACCAAGACTGCTTTCTTCTGCCCATAGACGGGGATGACTCAGCACTA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------->
-P--L--N--R--D--D--F--D--D--S--A--P--Q--Q--G--L--L--S--T--T--P--*-
CCCCTCAACAGAGATGACTTTGATGACTCTGCCCCTCAGCAGGGCTTACTAAGCACTACCCCTTAA
                                                                  
------------------------------------------------------------------
------------------------------------------------------------------