Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000099364 (click for geneview)
Transcript ID ENST00000338343(link to ensembl)
Symbol NP_061958.1
Localtion Chromosome:16:30841893:30867598:1 band: 16p11.2
Description F-box and leucine-rich repeat protein 19
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<-------------------------------------------------------------------------------------><------------
-M--G--K--A--E--G--V--I--N--A--E--I--P--N--C--W--E--C--P--R--C--T--Q--E--G--R--T--S--K--D--S--G--E--
ATGGGGAAGGCTGAGGGTGTCATCAATGCAGAGATCCCCAACTGCTGGGAGTGCCCTCGCTGCACCCAGGAAGGCCGCACCAGCAAGGATTCAGGTGAGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
G--P--G--R--R--R--A--D--N--G--E--E--G--A--S--L--G--S--G--W--K--L--T--E--E--P--P--L--P--P--P--P--P--R
GGCCTGGCCGCCGTAGGGCCGACAACGGCGAGGAGGGCGCCAGCTTGGGGAGCGGATGGAAGCTGACAGAGGAGCCACCGCTTCCACCGCCCCCGCCCAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--R--K--G--P--L--P--A--G--P--P--P--E--D--V--P--G--P--P--K--R--K--E--R--E--A--G--N--E--P--P--T--P--R-
GCGCAAGGGCCCCCTGCCTGCCGGGCCCCCCCCGGAGGACGTGCCTGGGCCCCCCAAACGAAAGGAAAGGGAGGCAGGGAATGAGCCTCCCACCCCAAGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----><-------------------------------><------------------------------------------------------------
-K--K--V--K--G--G--R--E--R--H--L--K--K--K--P--K--P--P--L--A--S--A--E--G--P--A--V--P--S--P--S--P--Q--
AAAAAGGTGAAAGGAGGCCGAGAGAGGCACCTGAAGAAGAAACCAAAGCCGCCTTTGGCCTCTGCAGAGGGCCCAGCGGTGCCGTCCCCGTCCCCGCAGA
                                       ::::::::::::::::::::::::: .:::::::::::.::::::::::: :: :: ::::
---------------------------------------AAACCAAAGCCGCCTTTGGCCTCTGGGGAGGGCCCAGCAGTGCCGTCCCCCTCACCCCAGA
----------------------------------------K--P--K--P--P--L--A--S--G--E--G--P--A--V--P--S--P--S--P--Q--

----------------------------------------------------------------------------------------------------
R--E--K--L--E--R--F--K--R--M--C--Q--L--L--E--R--V--P--D--T--S--S--S--S--S--D--S--D--S--D--S--D--S--S
GGGAGAAGCTAGAGCGTTTCAAGCGGATGTGCCAGCTGCTGGAACGGGTGCCTGACACCTCCTCTTCCTCCTCGGACTCAGACTCCGACTCCGACTCTTC
:::::::::::::.:::::::::::::::::.:::::::::::.:::::::::::::: ::::: :::::::::::::::::::: ::::::::::: ::
GGGAGAAGCTAGAACGTTTCAAGCGGATGTGTCAGCTGCTGGAGCGGGTGCCTGACACGTCCTCGTCCTCCTCGGACTCAGACTCGGACTCCGACTCATC
R--E--K--L--E--R--F--K--R--M--C--Q--L--L--E--R--V--P--D--T--S--S--S--S--S--D--S--D--S--D--S--D--S--S

----------------------------------------------------------------------------------------------------
--G--T--S--L--S--E--D--E--A--P--G--E--A--R--N--G--R--R--P--A--R--G--S--S--G--E--K--E--N--R--G--G--R-
GGGCACATCGCTGAGTGAGGACGAAGCCCCCGGCGAGGCCCGGAATGGGCGACGGCCAGCCCGGGGCAGCTCTGGCGAGAAGGAGAACCGTGGGGGGCGG
.::::::::::::::::::::.::.::.::.::::::::::::::.:::::::::::::::::::::::::: :::::::::::::::::.:::::::::
AGGCACATCGCTGAGTGAGGATGAGGCTCCTGGCGAGGCCCGGAACGGGCGACGGCCAGCCCGGGGCAGCTCGGGCGAGAAGGAGAACCGCGGGGGGCGG
--G--T--S--L--S--E--D--E--A--P--G--E--A--R--N--G--R--R--P--A--R--G--S--S--G--E--K--E--N--R--G--G--R-

----------------------------------------------------------------------------------------------------
-R--A--V--R--P--G--S--G--G--P--L--L--S--W--P--L--G--P--A--P--P--P--R--P--P--Q--L--E--R--H--V--V--R--
CGGGCTGTGCGCCCTGGCAGTGGGGGGCCCCTACTCAGCTGGCCCCTGGGCCCAGCCCCACCACCCCGGCCTCCACAGCTGGAGCGGCACGTGGTGCGGC
:::::::::::::::                                                                                     
CGGGCTGTGCGCCCT-------------------------------------------------------------------------------------
-R--A--V--R--P--------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
P--P--P--R--S--P--E--P--D--T--L--P--L--A--A--G--S--D--H--P--L--P--R--A--A--W--L--R--V--F--Q--H--L--G
CCCCGCCTCGAAGCCCTGAGCCCGACACACTCCCCTTGGCTGCTGGATCCGACCACCCCCTGCCCCGGGCCGCCTGGCTTCGCGTCTTCCAGCACCTCGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------><------------------------------------------------
--P--R--E--L--C--I--C--M--R--V--C--R--T--W--S--R--W--C--Y--D--K--R--L--W--P--R--M--D--L--S--R--R--K-
GCCGCGGGAGCTGTGTATCTGCATGCGAGTCTGCCGAACTTGGAGCCGCTGGTGCTATGACAAGCGTCTGTGGCCTCGAATGGACCTGAGCCGGCGGAAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-S--L--T--P--P--M--L--S--G--V--V--R--R--Q--P--R--A--L--D--L--S--W--T--G--V--S--K--K--Q--L--M--W--L--
TCACTGACCCCGCCCATGCTCAGTGGTGTGGTTCGCCGCCAGCCCCGTGCCCTGGACCTCAGCTGGACAGGTGTCTCCAAGAAGCAGCTCATGTGGCTTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------><------------------------------------------------------------------------------------
L--N--R--L--Q--G--L--Q--E--L--V--L--S--G--C--S--W--L--S--V--S--A--L--G--S--A--P--L--P--A--L--R--L--L
TGAACCGACTACAAGGCCTGCAGGAGCTGGTGCTCTCTGGCTGCTCCTGGCTCTCTGTCTCTGCCCTGGGCTCAGCCCCACTGCCAGCCCTGCGGCTCCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------><----------------------
--D--L--R--W--I--E--D--V--K--D--S--Q--L--R--E--L--L--L--P--P--P--D--T--K--P--G--Q--T--E--S--R--G--R-
GGACCTCCGCTGGATCGAGGATGTTAAAGACTCCCAGCTCCGGGAGTTGCTGCTGCCTCCACCAGACACCAAACCAGGGCAAACAGAGAGCCGTGGTCGG
                                                                               :::::.:::::::: :: :::
-------------------------------------------------------------------------------CAAACGGAGAGCCGAGGGCGG
--------------------------------------------------------------------------------Q--T--E--S--R--G--R-

----------------------------------------------------------------------------------------------------
-L--Q--G--V--A--E--L--R--L--A--G--L--E--L--T--D--A--S--L--R--L--L--L--R--H--A--P--Q--L--S--A--L--D--
CTGCAGGGGGTGGCAGAACTGCGTCTGGCAGGTTTGGAGCTGACAGATGCCTCCCTGCGTCTCCTGCTGCGTCACGCACCCCAGCTGAGCGCCCTGGACC
::::::::::: :: ::.:::::.:::::.:::.::::::::::.::.::::::.:::: :::::::::::.:::::.::::::::::::::::::::::
CTGCAGGGGGTCGCTGAGCTGCGCCTGGCGGGTCTGGAGCTGACGGACGCCTCCTTGCGGCTCCTGCTGCGCCACGCGCCCCAGCTGAGCGCCCTGGACC
-L--Q--G--V--A--E--L--R--L--A--G--L--E--L--T--D--A--S--L--R--L--L--L--R--H--A--P--Q--L--S--A--L--D--

-----------------------------------------------------------------------------------------------><---
L--S--H--C--A--H--V--G--D--P--S--V--H--L--L--T--A--P--T--S--P--L--R--E--T--L--V--H--L--N--L--A--G--C
TGAGCCACTGCGCCCACGTCGGGGACCCCAGTGTTCACCTCCTCACGGCCCCCACGTCCCCACTCCGCGAGACCCTGGTGCACCTCAATCTTGCTGGTTG
:::::::::::::::::::.:::::.:::::.::.:::::::::::::::::::: :::::.::::: :::::::::::.::::::::.::.:::   ::
TGAGCCACTGCGCCCACGTTGGGGATCCCAGCGTCCACCTCCTCACGGCCCCCACCTCCCCGCTCCGAGAGACCCTGGTACACCTCAACCTCGCT---TG
L--S--H--C--A--H--V--G--D--P--S--V--H--L--L--T--A--P--T--S--P--L--R--E--T--L--V--H--L--N--L--A-----C

----------------------------------------------------------------------------------------------------
--H--R--L--T--D--H--C--L--P--L--F--R--R--C--P--R--L--R--R--L--D--L--R--S--C--R--Q--L--S--P--E--A--C-
CCACCGCCTAACGGACCACTGCCTCCCGCTGTTCCGCCGCTGCCCTCGTCTACGCCGCCTAGACCTGCGCTCCTGCCGCCAGCTCTCACCCGAAGCTTGT
::::::::: ::::::::::::::::::: ::::::::::::::: ::.:: :::::::::::::::::::: :::::::::::::::::.:::      
CCACCGCCTCACGGACCACTGCCTCCCGCAGTTCCGCCGCTGCCCGCGCCTCCGCCGCCTAGACCTGCGCTCGTGCCGCCAGCTCTCACCTGAA------
--H--R--L--T--D--H--C--L--P--Q--F--R--R--C--P--R--L--R--R--L--D--L--R--S--C--R--Q--L--S--P--E-------

-------------------------------------------------------------------------->
-A--R--L--A--A--A--G--P--P--G--P--F--R--C--P--E--E--K--L--L--L--K--D--S--*-
GCCCGGCTGGCAGCTGCCGGGCCCCCTGGCCCCTTCCGCTGCCCTGAGGAGAAGCTGCTTCTCAAGGACAGCTAG
                                                                           
---------------------------------------------------------------------------
---------------------------------------------------------------------------

Pig Consensus Sequence

>BGISUST0000890780
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
---------------------------------------AAACCAAAGCCGCCTTTGGCCTCTGGGGAGGGCCCAGCAGTGCCGTCCCCCTCACCCCAGA
GGGAGAAGCTAGAACGTTTCAAGCGGATGTGTCAGCTGCTGGAGCGGGTGCCTGACACGTCCTCGTCCTCCTCGGACTCAGACTCGGACTCCGACTCATC
AGGCACATCGCTGAGTGAGGATGAGGCTCCTGGCGAGGCCCGGAACGGGCGACGGCCAGCCCGGGGCAGCTCGGGCGAGAAGGAGAACCGCGGGGGGCGG
CGGGCTGTGCGCCCT-------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
-------------------------------------------------------------------------------CAAACGGAGAGCCGAGGGCGG
CTGCAGGGGGTCGCTGAGCTGCGCCTGGCGGGTCTGGAGCTGACGGACGCCTCCTTGCGGCTCCTGCTGCGCCACGCGCCCCAGCTGAGCGCCCTGGACC
TGAGCCACTGCGCCCACGTTGGGGATCCCAGCGTCCACCTCCTCACGGCCCCCACCTCCCCGCTCCGAGAGACCCTGGTACACCTCAACCTCGCT---TG
CCACCGCCTCACGGACCACTGCCTCCCGCAGTTCCGCCGCTGCCCGCGCCTCCGCCGCCTAGACCTGCGCTCGTGCCGCCAGCTCTCACCTGAA------
---------------------------------------------------------------------------


>BGISUSP0000890780
----------------------------------------------------------------------------------------------------
-------------KPKPPLASGEGPAVPSPSPQREKLERFKRMCQLLERVPDTSSSSSDSDSDSDSSGTSLSEDEAPGEARNGRRPARGSSGEKENRGGR
RAVRP-----------------------------------------------------------------------------------------------
---------------------------------------------------------------------------------------------QTESRGR
LQGVAELRLAGLELTDASLRLLLRHAPQLSALDLSHCAHVGDPSVHLLTAPTSPLRETLVHLNLA-CHRLTDHCLPQFRRCPRLRRLDLRSCRQLSPE--
-------------------------