Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000188403 (click for geneview)
Transcript ID ENST00000338912(link to ensembl)
Symbol XP_496025.1
Localtion Chromosome:15:18429923:18438485:-1 band: 15q11.2
Description PREDICTED: similar to immunoglobulin heavy-chain-2 light-chain-2 VH segment
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<--------------------------------------------><-----------------------------------------------------
-M--D--W--T--W--S--I--L--F--L--V--A--A--A--T--G--A--Q--S--Q--V--Q--L--M--Q--S--G--A--E--V--K--K--P--
ATGGACTGGACCTGGAGCATCCTTTTCTTGGTGGCAGCAGCAACAGGTGCCCAGTCCCAGGTACAGCTGATGCAGTCTGGGGCTGAGGTGAAGAAGCCTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
G--A--S--V--R--I--S--C--K--A--S--G--Y--T--F--T--S--Y--C--M--H--W--V--C--Q--A--H--A--Q--G--L--E--W--M
GGGCCTCAGTGAGGATCTCCTGCAAGGCTTCTGGATACACCTTCACCAGCTACTGTATGCACTGGGTGTGCCAGGCCCATGCACAAGGGCTTGAGTGGAT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--G--L--V--C--P--S--D--G--S--T--S--Y--A--Q--K--F--Q--G--R--V--T--I--T--R--D--T--S--M--G--T--A--Y--M-
GGGATTGGTGTGCCCTAGTGATGGCAGCACAAGCTATGCACAGAAGTTCCAGGGCAGAGTCACCATAACCAGGGACACATCCATGGGCACAGCCTACATG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------------------------->
-E--L--S--S--L--R--S--E--D--T--A--M--Y--Y--C--V--R--D--T--M--*-
GAGCTAAGCAGCCTGAGATCTGAGGACACGGCCATGTATTACTGTGTGAGAGACACAATGTGA
                                                               
---------------------------------------------------------------
---------------------------------------------------------------