Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000114374 (click for geneview)
Transcript ID ENST00000338981(link to ensembl)
Symbol USP9Y
Localtion Chromosome:Y:13251291:13410221:1 band: Yq11.21
Description Probable ubiquitin carboxyl-terminal hydrolase FAF-Y (EC 3.1.2.15) (Ubiquitin thiolesterase FAF-Y) (Ubiquitin-specific processing protease FAF-Y) (Deubiquitinating enzyme FAF-Y) (Fat facets protein related, Y-linked) (Ubiquitin-specific protease 9, Y chro [Source:Uniprot/SWISSPROT;Acc:O00507]
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<----------------------------------------------------------------------------------------------><---
-M--T--A--I--T--H--G--S--P--V--G--G--N--D--S--Q--G--Q--V--L--D--G--Q--S--Q--H--L--F--Q--Q--N--Q--T--
ATGACAGCCATCACTCATGGCTCTCCAGTAGGAGGGAACGACAGCCAGGGCCAGGTTCTTGATGGCCAGTCTCAGCATCTCTTCCAACAGAACCAGACTT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
S--S--P--D--S--S--N--E--N--S--V--A--T--P--P--P--E--E--Q--G--Q--G--D--A--P--P--Q--H--E--D--E--E--P--A
CATCACCTGATTCTTCCAATGAGAATTCCGTAGCAACTCCTCCTCCAGAGGAACAAGGGCAAGGTGATGCCCCACCACAGCATGAAGATGAAGAGCCTGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------><------------------------------------------------------
--F--P--H--T--E--L--A--N--L--D--D--M--I--N--R--P--R--W--V--V--P--V--L--P--K--G--E--L--E--V--L--L--E-
ATTTCCACATACTGAGCTGGCAAACCTGGATGACATGATCAACAGGCCTCGATGGGTGGTTCCTGTTTTGCCAAAAGGGGAATTAGAAGTGCTTTTAGAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------><--------------------------------------------------------------------------
-A--A--I--D--L--S--V--K--G--L--D--V--K--S--E--A--C--Q--R--F--F--R--D--G--L--T--I--S--F--T--K--I--L--
GCTGCTATTGATCTTAGTGTAAAAGGCCTTGATGTTAAAAGTGAAGCATGCCAACGTTTTTTTCGAGATGGACTAACAATATCTTTCACTAAAATTCTTA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------><-------------------------------------------------------------
M--D--E--A--V--S--G--W--K--F--E--I--H--R--C--I--I--N--N--T--H--R--L--V--E--L--C--V--A--K--L--S--Q--D
TGGATGAGGCTGTGAGTGGCTGGAAGTTTGAAATTCATAGATGTATTATTAACAATACTCATCGCCTAGTGGAGCTTTGTGTGGCCAAGTTGTCCCAAGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--W--F--P--L--L--E--L--L--A--M--A--L--N--P--H--C--K--F--H--I--Y--N--G--T--R--P--C--E--L--I--S--S--N-
TTGGTTTCCACTTCTAGAACTTCTCGCCATGGCCTTAAATCCTCACTGCAAGTTTCATATCTACAATGGTACACGTCCGTGTGAATTAATTTCCTCAAAT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------------><------------------------------------------
-A--Q--L--P--E--D--E--L--F--A--R--S--S--D--P--R--S--P--K--G--W--L--V--D--L--I--N--K--F--G--T--L--N--
GCTCAGTTGCCTGAAGATGAATTATTTGCTCGTTCTTCAGATCCTCGATCACCAAAAGGTTGGCTAGTGGATCTCATCAATAAATTTGGCACATTAAATG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------------------------------------><--------------------------
G--F--Q--I--L--H--D--R--F--F--N--G--S--A--L--N--I--Q--I--I--A--A--L--I--K--P--F--G--Q--C--Y--E--F--L
GGTTCCAGATTTTGCATGATCGTTTTTTTAATGGATCAGCATTAAATATTCAAATAATTGCAGCTCTTATTAAACCATTTGGACAATGCTATGAGTTTCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--S--Q--H--T--L--K--K--Y--F--I--P--V--I--E--I--V--P--H--L--L--E--N--L--T--D--E--E--L--K--K--E--A--K-
CAGTCAACATACACTGAAAAAGTACTTCATTCCAGTTATAGAAATAGTTCCACATTTATTGGAAAACTTAACTGATGAAGAACTGAAAAAGGAGGCAAAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-N--E--A--K--N--D--A--L--S--M--I--I--K--S--L--K--N--L--A--S--R--I--S--G--Q--D--E--T--I--K--N--L--E--
AATGAAGCCAAAAATGATGCCCTTTCAATGATTATTAAATCTTTGAAGAACTTAGCTTCAAGAATTTCAGGACAAGATGAGACTATAAAAAATTTGGAAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------><--------------------------------------------------------------------------
I--F--R--L--K--M--I--L--R--L--L--Q--I--S--S--F--N--G--K--M--N--A--L--N--E--I--N--K--V--I--S--S--V--S
TTTTTAGGTTAAAGATGATACTCAGATTGTTGCAAATTTCCTCTTTTAATGGAAAGATGAATGCACTGAATGAAATAAATAAGGTTATATCTAGTGTATC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------------------------------------><-----------------------------------
--Y--Y--T--H--R--H--S--N--P--E--E--E--E--W--L--T--A--E--R--M--A--E--W--I--Q--Q--N--N--I--L--S--I--V-
ATATTATACTCATCGGCATAGTAATCCTGAGGAGGAAGAATGGCTGACAGCTGAGCGAATGGCAGAATGGATACAGCAAAATAATATCTTATCCATAGTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-L--Q--D--S--L--H--Q--P--Q--Y--V--E--K--L--E--K--I--L--R--F--V--I--K--E--K--A--L--T--L--Q--D--L--D--
TTGCAAGACAGTCTTCATCAACCACAATATGTAGAAAAGCTAGAGAAAATTCTTCGTTTTGTGATTAAAGAAAAGGCTCTTACATTACAGGACCTTGATA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------><----------------------------------------------------------------------------------
N--I--W--A--A--Q--A--G--K--H--E--A--I--V--K--N--V--H--D--L--L--A--K--L--A--W--D--F--S--P--G--Q--L--D
ATATCTGGGCAGCACAGGCAGGAAAACATGAAGCCATTGTGAAGAATGTACATGATCTGCTAGCAAAGTTGGCTTGGGATTTTTCTCCTGGACAACTTGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------><-----------------------------------------------------------------------------
--H--L--F--D--C--F--K--A--S--W--T--N--A--S--K--K--Q--R--E--K--L--L--E--L--I--R--R--L--A--E--D--D--K-
TCATCTTTTTGATTGCTTTAAGGCAAGTTGGACAAATGCAAGTAAAAAGCAACGTGAAAAGCTCCTTGAGTTGATACGCCGTCTTGCAGAAGATGATAAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-D--G--V--M--A--H--K--V--L--N--L--L--W--N--L--A--Q--S--D--D--V--P--V--D--I--M--D--L--A--L--S--A--H--
GATGGTGTGATGGCACACAAAGTGTTGAACCTTCTTTGGAACCTGGCTCAGAGTGATGATGTGCCTGTAGACATCATGGACCTTGCTCTTAGTGCCCACA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------><----------------------------------------------------------------------
I--K--I--L--D--Y--S--C--S--Q--D--R--D--A--Q--K--I--Q--W--I--D--H--F--I--E--E--L--R--T--N--D--K--W--V
TAAAAATACTAGATTATAGTTGTTCCCAGGATCGAGATGCACAGAAGATCCAGTGGATAGATCACTTTATAGAAGAACTTCGCACAAATGACAAGTGGGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------------------------------------------><---------------------------------
--I--P--A--L--K--Q--I--R--E--I--C--S--L--F--G--E--A--S--Q--N--L--S--Q--T--Q--R--S--P--H--I--F--Y--R-
AATTCCTGCTCTGAAACAAATAAGAGAAATTTGTAGTTTGTTTGGTGAAGCATCTCAAAATTTGAGTCAAACTCAGCGAAGTCCCCACATATTTTATCGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------------------------------------------------------->
-H--D--L--I--N--Q--L--Q--Q--N--H--A--L--V--T--L--V--A--E--N--L--A--T--Y--M--N--S--I--R--L--Y--A--G--
CATGATTTAATCAACCAGCTTCAACAAAATCATGCTTTAGTTACTTTGGTAGCAGAAAACCTTGCAACCTACATGAATAGCATCAGATTGTATGCTGGAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

<--------------------------------------------------------------------------------------><-----------
D--H--E--D--Y--D--P--Q--T--V--R--L--G--S--R--Y--S--H--V--Q--E--V--Q--E--R--L--N--F--L--R--F--L--L--K
ATCATGAAGACTATGATCCACAAACAGTGAGGCTTGGAAGTCGATACAGTCATGTTCAAGAAGTTCAAGAACGACTAAACTTCCTTAGATTTTTACTGAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--D--G--Q--L--W--L--C--A--P--Q--A--K--Q--I--W--K--C--L--A--E--N--A--V--Y--L--C--D--R--E--A--C--F--K-
GGATGGCCAACTGTGGCTCTGTGCTCCTCAGGCAAAACAAATATGGAAGTGCTTAGCAGAAAATGCAGTTTATCTTTGTGATCGTGAAGCCTGTTTTAAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-W--Y--S--K--L--M--G--D--E--P--D--L--D--P--D--I--N--K--D--F--F--E--S--N--V--L--Q--L--D--P--S--L--L--
TGGTATTCCAAGTTAATGGGGGATGAACCAGACTTGGATCCTGATATTAATAAGGACTTCTTTGAAAGTAATGTACTTCAGCTTGATCCTTCCCTTTTAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
T--E--N--G--M--K--C--F--E--R--F--F--K--A--V--N--C--R--E--R--K--L--I--A--K--R--R--S--Y--M--M--D--D--L
CTGAAAATGGAATGAAATGCTTTGAAAGATTTTTCAAAGCTGTCAATTGTCGAGAAAGGAAACTAATAGCAAAAAGAAGATCCTATATGATGGATGATTT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------><--------------------------------------------------------------------
--E--L--I--G--L--D--Y--L--W--R--V--V--I--Q--S--S--D--E--I--A--N--R--A--I--D--L--L--K--E--I--Y--T--N-
GGAATTAATTGGACTAGACTACCTTTGGAGGGTTGTGATTCAGAGTAGTGACGAGATTGCTAACAGAGCTATAGATCTTCTTAAAGAGATATACACAAAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------><------------------------------------------------------------------------
-L--G--P--R--L--K--A--N--Q--V--V--I--H--E--D--F--I--Q--S--C--F--D--R--L--K--A--S--Y--D--T--L--C--V--
CTTGGCCCAAGATTAAAAGCCAATCAGGTGGTTATCCATGAAGACTTCATTCAGTCTTGCTTTGATCGTTTAAAAGCATCATATGATACACTGTGTGTTT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
F--D--G--D--K--N--S--I--N--C--A--R--Q--E--A--I--R--M--V--R--V--L--T--V--I--K--E--Y--I--N--E--C--D--S
TTGATGGTGACAAAAACAGCATTAATTGTGCAAGACAAGAAGCCATTCGAATGGTTAGAGTATTAACTGTTATAAAAGAGTACATTAATGAATGTGACAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------><------------------------------------------------------------
--D--Y--H--K--E--R--M--I--L--P--M--S--R--A--F--R--G--K--H--L--S--L--I--V--R--F--P--N--Q--G--R--Q--V-
TGATTATCACAAGGAAAGAATGATTCTACCTATGTCGAGAGCATTTCGTGGCAAACACCTCTCTCTTATAGTTCGGTTTCCAAACCAGGGCAGACAGGTT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-D--E--L--D--I--W--S--H--T--N--D--T--I--G--S--V--R--R--C--I--V--N--R--I--K--A--N--V--A--H--K--K--I--
GATGAGTTGGATATATGGTCTCATACGAATGACACAATTGGTTCAGTACGGCGATGTATTGTTAATCGTATTAAAGCCAATGTAGCCCACAAAAAAATTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------------------------------------------><-------------------
E--L--F--V--G--G--E--L--I--D--S--E--D--D--R--K--L--I--G--Q--L--N--L--K--D--K--S--L--I--T--A--K--L--T
AACTTTTTGTGGGTGGTGAGCTGATAGATTCTGAAGATGACAGAAAGCTAATTGGACAATTAAACTTAAAAGATAAATCTCTAATTACAGCCAAACTTAC
                                                                                ::::::::::::::::::::
--------------------------------------------------------------------------------CTAATTACAGCCAAACTTAC
---------------------------------------------------------------------------------L--I--T--A--K--L--T

----------------------------------------------------------------------------------------------------
--Q--I--N--F--N--M--P--S--S--P--D--S--S--S-----D--S--S--T--A--S--P--G--N--H--R--N--H--Y--N--D--G--P-
ACAAATAAATTTCAATATGCCATCAAGTCCTGATAGCTCTTCC---GATTCCTCAACTGCATCTCCTGGAAACCACCGTAATCATTACAATGATGGTCCC
.:::.:::.::.::::::::: :::::.::::::::::::::.   ::::::::::::: :::::::::::::::. ::::::::::::. :::::::::
GCAAGTAAGTTCCAATATGCCTTCAAGCCCTGATAGCTCTTCTA--GATTCCTCAACTGGATCTCCTGGAAACCATGGTAATCATTACAGGGATGGTCCC
--Q--V--S--S--N--M--P--S--S--P--D--S--S--S--\--D--S--S--T--G--S--P--G--N--H--G--N--H--Y--R--D--G--P-

--------------------------------><------------------------------------------------------------------
-N--L--E--V--E--S--C--L--P--G--V--I--M--S--V--H--P--R--Y--I--S--F--L--W--Q--V--A--D--L--G--S--N--L--
AATCTAGAGGTGGAAAGTTGTTTGCCTGGGGTGATAATGTCAGTGCATCCCAGATACATCTCTTTCCTTTGGCAAGTTGCAGACTTAGGTAGCAACCTGA
::::.:::.:::::.::.::.::::::::::::::::::::: :::::::::::::::: ::::::::::::::::: ::::::::.:: ::::..::.:
AATCCAGAAGTGGAGAGCTGCTTGCCTGGGGTGATAATGTCATTGCATCCCAGATACATNTCTTTCCTTTGGCAAGTGGCAGACTTGGGAAGCAGTCTAA
-N--P--E--V--E--S--C--L--P--G--V--I--M--S--L--H--P--R--Y--X--S--F--L--W--Q--V--A--D--L--G--S--S--L--

-----------------------------------------------------><---------------------------------------------
N--M--P--P--L--R--D--G--A--R--V--L--M--K--L--M--P--P--D--R--T--A--V--E--K--L--R--A--V--C--L--D--H--A
ATATGCCACCTCTTAGAGATGGAGCAAGAGTACTTATGAAACTTATGCCACCAGATAGAACAGCTGTAGAAAAATTACGAGCTGTTTGTTTGGACCATGC
:::::::::::::::::::::::::::::::::::::::::::::::::::::                                               
ATATGCCACCTCTTAGAGATGGAGCAAGAGTACTTATGAAACTTATGCCACCA-----------------------------------------------
N--M--P--P--L--R--D--G--A--R--V--L--M--K--L--M--P--P------------------------------------------------

------------------------------------------------------------------------------------><--------------
--K--L--G--E--G--K--L--S--P--P--L--D--S--L--F--F--G--P--S--A--S--Q--V--L--Y--L--T--E--V--V--Y--A--L-
AAAACTTGGAGAAGGCAAACTTAGTCCACCCCTTGACTCTCTTTTCTTTGGTCCTTCTGCCTCCCAAGTTCTATACCTAACAGAGGTAGTTTATGCCTTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-L--M--P--A--G--V--P--L--T--D--G--S--S--D--F--Q--V--H--F--L--K--S--G--G--L--P--L--V--L--S--M--L--I--
TTAATGCCTGCTGGTGTGCCTCTAACTGATGGGTCCTCTGACTTTCAAGTTCACTTCTTGAAAAGTGGTGGCTTACCTCTTGTACTGAGTATGCTAATAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
R--N--N--F--L--P--N--T--D--M--E--T--R--R--G--A--Y--L--N--A--L--K--I--A--K--L--L--L--T--A--I--G--Y--G
GAAATAACTTCTTGCCAAATACAGATATGGAAACTCGAAGGGGTGCTTATTTAAATGCTCTTAAAATAGCCAAACTGTTGTTAACTGCGATTGGCTATGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------------------------------------><-----------------------------------
--H--V--R--A--V--A--E--A--C--Q--P--V--V--D--G--T--D--P--I--T--Q--I--N--Q--V--T--H--D--Q--A--V--V--L-
CCATGTTCGAGCTGTAGCAGAAGCTTGTCAGCCAGTTGTAGATGGTACAGACCCCATAACACAGATTAACCAAGTTACTCATGATCAAGCAGTGGTGCTA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------------------------------------------------------------------><---------
-Q--S--A--L--Q--S--I--P--N--P--S--S--E--C--V--L--R--N--E--S--I--L--L--A--Q--E--I--S--N--E--A--S--R--
CAAAGTGCCCTTCAGAGCATTCCTAATCCCTCATCCGAGTGCGTACTTAGAAATGAGTCCATACTTCTTGCTCAGGAAATATCTAATGAGGCTTCAAGAT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
Y--M--P--D--I--C--V--I--R--A--I--Q--K--I--I--W--A--S--A--C--G--A--L--G--L--V--F--S--P--N--E--E--I--T
ATATGCCTGATATTTGTGTAATTAGGGCTATACAGAAAATTATCTGGGCATCAGCATGTGGGGCATTAGGACTAGTTTTTAGCCCAAATGAAGAAATAAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------><-----------------------------------------------------------------------------------
--K--I--Y--Q--M--T--T--N--G--S--N--K--L--E--V--E--D--E--Q--V--C--C--E--A--L--E--V--M--T--L--C--F--A-
TAAAATTTATCAGATGACCACCAATGGAAGCAATAAGCTGGAGGTGGAAGATGAACAAGTTTGCTGTGAAGCACTGGAAGTGATGACCTTATGTTTTGCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------------------------------------------------><-------------
-L--L--P--T--A--L--D--A--L--S--K--E--K--A--W--Q--T--F--I--I--D--L--L--L--H--C--P--S--K--T--V--R--Q--
TTACTTCCAACAGCGTTGGATGCACTTAGTAAAGAAAAAGCCTGGCAGACCTTCATCATTGACTTATTATTGCACTGTCCAAGCAAAACTGTTCGTCAGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------><----
L--A--Q--E--Q--F--F--L--M--C--T--R--C--C--M--G--H--R--P--L--L--F--F--I--T--L--L--F--T--I--L--G--S--T
TGGCACAGGAGCAGTTCTTTTTAATGTGCACCAGATGTTGCATGGGACACAGGCCTCTGCTTTTCTTCATTACTTTACTCTTTACCATACTGGGGAGCAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--A--R--E--K--G--K--Y--S--G--D--Y--F--T--L--L--R--H--L--L--N--Y--A--Y--N--G--N--I--N--I--P--N--A--E-
AGCAAGAGAGAAGGGTAAATATTCAGGTGATTATTTCACACTTTTACGGCACCTTCTCAATTATGCTTACAATGGCAATATTAACATACCCAATGCTGAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------------------><---------------------------------------------------------
-V--L--L--V--S--E--I--D--W--L--K--R--I--R--D--N--V--K--N--T--G--E--T--G--V--E--E--P--I--L--E--G--H--
GTTCTTCTTGTCAGTGAAATTGATTGGCTCAAAAGGATTAGGGATAATGTTAAAAACACAGGTGAAACAGGTGTCGAAGAGCCAATACTGGAAGGCCACC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------><----------
L--G--V--T--K--E--L--L--A--F--Q--T--S--E--K--K--Y--H--F--G--C--E--K--G--G--A--N--L--I--K--E--L--I--D
TTGGGGTAACAAAAGAGTTATTGGCCTTTCAAACTTCTGAGAAAAAGTATCACTTTGGTTGTGAAAAAGGAGGTGCTAATCTCATTAAAGAATTAATTGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--D--F--I--F--P--A--S--K--V--Y--L--Q--Y--L--R--S--G--E--L--P--A--E--Q--A--I--P--V--C--S--S--P--V--T-
TGATTTCATCTTTCCCGCATCCAAAGTTTACCTGCAGTATTTAAGAAGTGGAGAACTACCAGCTGAGCAGGCTATTCCAGTCTGTAGTTCACCCGTTACC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-I--N--A--G--F--E--L--L--V--A--L--A--I--G--C--V--R--N--L--K--Q--I--V--D--C--L--T--E--M--Y--Y--M--G--
ATCAATGCCGGTTTTGAGCTACTTGTAGCATTAGCTATTGGCTGTGTGAGGAATCTCAAACAGATAGTAGACTGTTTGACTGAAATGTATTACATGGGCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------><---------------------------------------------------------------------------------------
T--A--I--T--T--C--E--A--L--T--E--W--E--Y--L--P--P--V--G--P--R--P--P--K--G--F--V--G--L--K--N--A--G--A
CAGCAATTACTACTTGTGAAGCACTTACTGAGTGGGAATATCTGCCCCCTGTTGGACCCCGCCCACCAAAAGGATTTGTGGGACTCAAAAATGCTGGTGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--T--C--Y--M--N--S--V--I--Q--Q--L--Y--M--I--P--S--I--R--N--S--I--L--A--I--E--G--T--G--S--D--L--H--D-
TACGTGTTACATGAACTCTGTGATCCAGCAGCTATACATGATTCCTTCTATCAGGAACAGTATTCTTGCAATTGAAGGCACAGGTAGTGATTTACACGAT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------><------------------------------------------------------------------
-D--M--F--G--D--E--K--Q--D--S--E--S--N--V--D--P--R--D--D--V--F--G--Y--P--H--Q--F--E--D--K--P--A--L--
GATATGTTCGGGGATGAGAAGCAGGACAGTGAGAGTAATGTTGATCCCCGAGATGATGTATTTGGATATCCTCATCAATTTGAAGACAAGCCAGCATTAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
S--K--T--E--D--R--K--E--Y--N--I--G--V--L--R--H--L--Q--V--I--F--G--H--L--A--A--S--Q--L--Q--Y--Y--V--P
GTAAGACAGAAGATAGGAAAGAGTATAATATTGGTGTCCTAAGACACCTTCAGGTCATCTTTGGTCATTTAGCTGCTTCCCAACTACAATACTATGTACC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------><---------------------------------------------------------------------------
--R--G--F--W--K--Q--F--R--L--W--G--E--P--V--N--L--R--E--Q--H--D--A--L--E--F--F--N--S--L--V--D--S--L-
CAGAGGATTTTGGAAACAGTTCAGGCTTTGGGGTGAACCTGTTAATCTCCGTGAACAACATGATGCCTTAGAGTTTTTTAATTCTTTGGTGGATAGTTTA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------------------------------------------------------------><-
-D--E--A--L--K--A--L--G--H--P--A--I--L--S--K--V--L--G--G--S--F--A--D--Q--K--I--C--Q--G--C--P--H--R--
GATGAAGCTTTAAAAGCTTTAGGACACCCGGCTATACTAAGTAAAGTCCTAGGAGGCTCCTTTGCTGATCAGAAGATCTGCCAAGGCTGCCCACATAGGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
Y--E--C--E--E--S--F--T--T--L--N--V--D--I--R--N--H--Q--N--L--L--D--S--L--E--Q--Y--I--K--G--D--L--L--E
ATGAATGTGAAGAATCTTTTACAACTTTGAATGTGGATATTAGAAATCATCAAAATCTTCTTGACTCTTTGGAACAGTATATCAAAGGAGATTTATTGGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------------><-----------------------------------------------------------
--G--A--N--A--Y--H--C--E--K--C--D--K--K--V--D--T--V--K--R--L--L--I--K--K--L--P--R--V--L--A--I--Q--L-
AGGTGCAAATGCATATCATTGTGAAAAATGTGATAAAAAGGTTGACACAGTAAAGCGCCTGCTAATTAAAAAATTGCCTCGGGTTCTTGCTATCCAACTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-K--R--F--D--Y--D--W--E--R--E--C--A--I--K--F--N--D--Y--F--E--F--P--R--E--L--D--M--G--P--Y--T--V--A--
AAACGATTTGACTATGACTGGGAAAGAGAATGTGCAATTAAATTCAATGATTATTTTGAATTTCCTCGAGAGCTGGATATGGGACCTTACACAGTAGCAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
G--V--A--N--L--E--R--D--N--V--N--S--E--N--E--L--I--E--Q--K--E--Q--S--D--N--E--T--A--G--G--T--K--Y--R
GTGTTGCAAACCTGGAAAGGGATAATGTAAACTCAGAAAATGAGTTGATTGAACAGAAAGAGCAGTCTGACAATGAAACTGCAGGAGGCACAAAGTACAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--L--V--G--V--L--V--H--S--G--Q--A--S--G--G--H--Y--Y--S--Y--I--I--Q--R--N--G--K--D--D--Q--T--D--H--W-
ACTTGTAGGAGTGCTTGTACACAGTGGTCAAGCAAGCGGTGGGCATTATTATTCTTACATCATTCAAAGGAATGGTAAAGATGATCAGACAGATCACTGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-Y--K--F--D--D--G--D--V--T--E--C--K--M--D--D--D--E--E--M--K--N--Q--C--F--G--G--E--Y--M--G--E--V--F--
TATAAATTTGATGATGGAGATGTAACAGAATGCAAAATGGATGATGATGAAGAAATGAAAAATCAGTGTTTTGGTGGAGAGTACATGGGAGAAGTATTTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
D--H--M--M--K--R--M--S--Y--R--R--Q--K--R--W--W--N--A--Y--I--L--F--Y--E--Q--M--D--M--I--D--E--D--D--E
ATCACATGATGAAGCGCATGTCATATAGGCGACAGAAGAGGTGGTGGAATGCTTACATACTTTTTTATGAACAAATGGATATGATAGATGAAGATGATGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--M--I--R--Y--I--S--E--L--T--I--A--R--P--H--Q--I--I--M--S--P--A--I--E--R--S--V--R--K--Q--N--V--K--F-
GATGATAAGATACATATCAGAGCTAACTATTGCAAGACCCCATCAGATCATTATGTCACCAGCCATTGAGAGAAGTGTACGGAAACAAAATGTGAAATTT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------------------------------------------------------><--------
-M--H--N--R--L--Q--Y--S--L--E--Y--F--Q--F--V--K--K--L--L--T--C--N--G--V--Y--L--N--P--A--P--G--Q--D--
ATGCATAACCGATTGCAATATAGTTTAGAGTATTTTCAGTTTGTGAAAAAACTGCTTACATGTAATGGTGTTTATTTAAACCCTGCTCCAGGGCAGGATT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
Y--L--L--P--E--A--E--E--I--T--M--I--S--I--Q--L--A--A--R--F--L--F--T--T--G--F--H--T--K--K--I--V--R--G
ATTTGTTGCCTGAAGCAGAAGAAATTACTATGATTAGTATTCAGCTTGCTGCTAGATTCCTCTTTACCACTGGATTTCACACCAAGAAAATAGTTCGTGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------><------------------------------------------------------------------------------------
--P--A--S--D--W--Y--D--A--L--C--V--L--L--R--H--S--K--N--V--R--F--W--F--T--H--N--V--L--F--N--V--S--N-
TCCTGCCAGTGACTGGTATGATGCACTGTGCGTTCTTCTCCGTCACAGCAAAAATGTACGTTTTTGGTTTACTCATAATGTCCTTTTTAATGTATCAAAT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-R--F--S--E--Y--L--L--E--C--P--S--A--E--V--R--G--A--F--A--K--L--I--V--F--I--A--H--F--S--L--Q--D--G--
CGCTTCTCTGAATACCTTCTGGAGTGCCCTAGTGCAGAAGTGAGGGGTGCATTTGCAAAACTTATAGTGTTTATTGCACACTTTTCCTTGCAAGATGGGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------><----------------------------------------------------------
S--C--P--S--P--F--A--S--P--G--P--S--S--Q--A--C--D--N--L--S--L--S--D--H--L--L--R--A--T--L--N--L--L--R
CTTGTCCTTCTCCTTTTGCATCTCCAGGACCTTCTAGTCAGGCATGTGATAACTTGAGCTTGAGTGACCACTTACTAAGAGCCACACTAAATCTCTTGAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------><----------------------------
--R--E--V--S--E--H--G--H--H--L--Q--Q--Y--F--N--L--F--V--M--Y--A--N--L--G--V--A--E--K--T--Q--L--L--K-
AAGGGAAGTTTCAGAGCATGGACATCATTTACAGCAATATTTTAATTTGTTTGTAATGTATGCCAATTTAGGTGTGGCAGAAAAAACACAGCTTCTGAAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-L--N--V--P--A--T--F--M--L--V--S--L--D--E--G--P--G--P--P--I--K--Y--Q--Y--A--E--L--G--K--L--Y--S--V--
TTGAATGTACCTGCTACCTTTATGCTTGTGTCTTTAGACGAAGGACCAGGTCCTCCAATCAAATATCAGTATGCTGAATTAGGCAAGTTATATTCAGTAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------------><------------------------------------------
V--S--Q--L--I--R--C--C--N--V--S--S--T--M--Q--S--S--I--N--G--N--P--P--L--P--N--P--F--G--D--L--N--L--S
TGTCTCAGCTGATTCGTTGTTGCAATGTGTCATCAACAATGCAGTCTTCAATCAATGGTAATCCCCCTCTCCCCAATCCTTTCGGTGACCTTAATTTATC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--Q--P--I--M--P--I--Q--Q--N--V--L--D--I--L--F--V--R--T--S--Y--V--K--K--I--I--E--D--C--S--N--S--E--D-
ACAGCCTATAATGCCAATTCAGCAGAATGTGTTAGACATTTTATTTGTGAGAACAAGTTATGTGAAGAAAATTATTGAAGACTGCAGTAACTCAGAGGAT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------------------------------------------------------><---------------------
-T--I--K--L--L--R--F--C--S--W--E--N--P--Q--F--S--S--T--V--L--S--E--L--L--W--Q--V--A--Y--S--Y--T--Y--
ACCATCAAATTACTTCGCTTTTGCTCTTGGGAGAATCCTCAGTTCTCATCTACTGTCCTCAGCGAACTTCTCTGGCAGGTTGCATATTCATATACCTATG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------------------------------><--------------------------------
E--L--R--P--Y--L--D--L--L--F--Q--I--L--L--I--E--D--S--W--Q--T--H--R--I--H--N--A--L--K--G--I--P--D--D
AACTTCGGCCATATTTAGATCTACTTTTCCAAATTTTACTGATTGAGGACTCCTGGCAGACTCACAGAATTCATAATGCACTTAAAGGAATTCCAGATGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--R--D--G--L--F--D--T--I--Q--R--S--K--N--H--Y--Q--K--R--A--Y--Q--C--I--K--C--M--V--A--L--F--S--S--C-
CAGAGATGGGCTGTTCGATACAATACAGCGCTCGAAGAATCACTATCAAAAACGAGCATATCAGTGCATAAAATGTATGGTAGCTCTATTTAGCAGTTGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------><---------------------------------------------------------------------------
-P--V--A--Y--Q--I--L--Q--G--N--G--D--L--K--R--K--W--T--W--A--V--E--W--L--G--D--E--L--E--R--R--P--Y--
CCTGTTGCTTACCAGATCTTACAGGGTAACGGAGATCTTAAAAGAAAATGGACCTGGGCAGTGGAATGGCTAGGAGATGAACTTGAAAGAAGACCATATA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
T--G--N--P--Q--Y--S--Y--N--N--W--S--P--P--V--Q--S--N--E--T--A--N--G--Y--F--L--E--R--S--H--S--A--R--M
CTGGCAATCCTCAGTATAGTTACAACAATTGGTCTCCTCCAGTACAAAGCAATGAAACAGCAAATGGTTATTTCTTAGAAAGATCACATAGTGCTAGGAT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------><--------------------------------------------------------------
--T--L--A--K--A--C--E--L--C--P--E--E--E--P--D--D--Q--D--A--P--D--E--H--E--P--S--P--S--E--D--A--P--L-
GACACTTGCAAAAGCTTGTGAACTCTGTCCAGAAGAGGAGCCAGATGACCAGGATGCCCCAGATGAGCATGAGCCCTCTCCATCAGAAGATGCCCCATTA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------><------------------------------------------------------------------
-Y--P--H--S--P--A--S--Q--Y--Q--Q--N--N--H--V--H--G--Q--P--Y--T--G--P--A--A--H--H--L--N--N--P--Q--K--
TATCCTCATTCACCTGCCTCTCAGTATCAACAGAATAATCATGTACATGGACAGCCATATACAGGACCAGCAGCACATCACTTGAACAACCCTCAGAAAA
                                 ::.:::::.:: ::.:::::::::::::::::.:::::::::::::::::.::::::: :::::::.
---------------------------------AACAATCACGTTCACGGACAGCCATATACAGGGCCAGCAGCACATCACTTAAACAACCATCAGAAAG
----------------------------------N--N--H--V--H--G--Q--P--Y--T--G--P--A--A--H--H--L--N--N--H--Q--K--

---------------------------------------------------------------------->
T--G--Q--R--T--Q--E--N--Y--E--G--N--E--E--V--S--S--P--Q--M--K--D--Q--*-
CAGGCCAACGAACACAAGAAAATTATGAAGGCAATGAAGAAGTATCCTCACCTCAGATGAAGGATCAGTGA
. :::::::::.::::::::::::::::::::::::::::::::::: ::.::::.:::::::::::::::
TTGGCCAACGAGCACAAGAAAATTATGAAGGCAATGAAGAAGTATCCGCATCTCAAATGAAGGATCAGTGA
V--G--Q--R--A--Q--E--N--Y--E--G--N--E--E--V--S--A--S--Q--M--K--D--Q--*-

Pig Consensus Sequence

>BGISUST0000886051
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
--------------------------------------------------------------------------------CTAATTACAGCCAAACTTAC
GCAAGTAAGTTCCAATATGCCTTCAAGCCCTGATAGCTCTTCtgATTCCTCAACTGGATCTCCTGGAAACCATGGTAATCATTACAGGGATGGTCCCAAT
CCAGAAGTGGAGAGCTGCTTGCCTGGGGTGATAATGTCATTGCATCCCAGATACATNTCTTTCCTTTGGCAAGTGGCAGACTTGGGAAGCAGTCTAAATA
TGCCACCTCTTAGAGATGGAGCAAGAGTACTTATGAAACTTATGCCACCA--------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
------------------------------AACAATCACGTTCACGGACAGCCATATACAGGGCCAGCAGCACATCACTTAAACAACCATCAGAAAGTTG
GCCAACGAGCACAAGAAAATTATGAAGGCAATGAAGAAGTATCCGCATCTCAAATGAAGGATCAGTGA


>BGISUSP0000886051
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
------------------------------------------------------------LITAKLTQVSSNMPSSPDSSSDSSTGSPGNHGNHYRDGPN
PEVESCLPGVIMSLHPRY-SFLWQVADLGSSLNMPPLRDGARVLMKLMPP--------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------NNHVHGQPYTGPAAHHLNNHQKVGQRAQENYEGNEEVSASQMKDQ*