Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000187667 (click for geneview)
Transcript ID ENST00000340286(link to ensembl)
Symbol Q52M16_HUMAN
Localtion Chromosome:15:20746157:20759705:-1 band: 15q11.2
Description  
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<----------------------------------------------------------------------------------------------><---
-G--C--A--T--V--R--D--A--L--F--A--A--N--G--R--A--A--D--C--E--S--P--R--E--F--R--E--R--A--L--R--A--M--
GGCTGCGCCACCGTGCGCGACGCTCTCTTCGCGGCTAACGGCCGCGCGGCCGACTGCGAGAGCCCGCGCGAGTTTCGGGAGCGGGCCCTGCGCGCCATGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------><------------------------------------------------------------------------
G--R--G--G--R--A--A--A--S--G--H--R--K--A--N--T--M--V--A--L--M--K--V--Y--Q--E--E--D--E--A--Y--Q--E--L
GTCGAGGCGGACGCGCGGCTGCGTCAGGACACCGAAAAGCCAACACCATGGTAGCATTAATGAAAGTTTACCAAGAGGAAGATGAAGCCTACCAGGAATT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------------------------------------------------------><--------
--V--T--V--A--T--T--F--F--Q--Y--L--L--Q--P--F--R--A--M--R--E--V--A--T--L--C--K--L--D--I--L--K--S--L-
AGTTACCGTGGCAACCACGTTCTTCCAGTACTTACTGCAGCCATTTAGGGCTATGCGAGAAGTTGCAACTTTATGTAAGCTTGATATTTTGAAGTCCTTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-D--E--D--D--L--G--P--R--R--V--V--A--L--E--K--E--A--E--E--W--T--R--R--A--G--E--A--V--V--S--I--Q--D--
GATGAGGATGACCTAGGTCCTAGAAGGGTAGTTGCCCTGGAGAAAGAAGCTGAAGAATGGACCAGACGGGCTGGAGAAGCTGTCGTCTCTATTCAAGATA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------------------><---------------------------------------------------------
I--T--V--N--Y--F--K--E--T--V--K--A--L--A--G--M--Q--K--E--M--E--Q--D--V--K--R--F--G--Q--A--A--W--A--T
TCACAGTGAATTATTTTAAGGAGACAGTAAAAGCATTAGCAGGAATGCAGAAAGAAATGGAACAGGATGTGAAGAGATTTGGCCAGGCTGCCTGGGCCAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--A--I--P--R--L--E--K--L--K--L--M--L--A--Q--E--T--L--Q--L--M--R--A--K--E--L--C--L--N--H--K--R--A--E-
AGCAATTCCCAGGTTGGAAAAACTTAAGCTAATGCTAGCTCAAGAGACTCTGCAACTCATGAGAGCGAAAGAGTTATGTTTAAATCACAAAAGAGCTGAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------><---------------------------------------------------------------------------------------
-I--Q--G--K--M--E--D--L--P--E--Q--E--K--N--I--N--V--V--D--E--L--A--I--Q--F--Y--E--I--Q--L--E--L--Y--
ATTCAGGGAAAGATGGAAGATCTTCCAGAACAAGAAAAAAATATAAATGTTGTAGATGAATTAGCAATACAATTTTATGAAATTCAGTTAGAACTATATG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------------------------------------------------------><---------------------
E--V--K--F--E--I--L--K--N--K--E--I--L--L--T--T--Q--L--D--S--L--E--R--L--I--K--E--K--Q--D--E--V--V--Y
AAGTTAAATTTGAGATATTAAAAAACAAAGAAATACTGCTTACTACACAGTTGGACTCTCTTGAAAGACTTATAAAAGAAAAACAGGATGAAGTTGTCTA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------><--------------------------------------------------------------------
--Y--D--P--C--E--S--P--E--E--L--S--L--T--V--V--G--L--Q--D--D--K--N--S--E--V--K--E--L--R--R--Q--C--Q-
TTACGATCCATGTGAAAGTCCAGAGGAACTTTCATTGACTGTGGTGGGGCTGCAGGACGATAAGAATTCGGAAGTGAAAGAACTCAGAAGGCAGTGCCAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------->
-Q--L--E--S--I--K--R--G--R--I--C--V--K--R--A--S--L--Q--S--R-
CAGCTGGAGTCTATTAAACGGGGCAGGATCTGTGTCAAAAGAGCTTCTCTCCAGAGTAGA
                                                            
------------------------------------------------------------
------------------------------------------------------------