Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000188958 (click for geneview)
Transcript ID ENST00000340524(link to ensembl)
Symbol UTS2B_HUMAN
Localtion Chromosome:3:192468877:192482729:-1 band: 3q28
Description Urotensin-2B precursor (Urotensin-IIB) (U-IIB) (UIIB) (Urotensin II- related peptide).
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--N--K--I--L--S--S--T--V--C--F--G--L--L--T--L--L--S--V--L--S--F--L--Q--S--V--H--G--R--P--Y--L--T--
ATGAACAAGATCCTCTCAAGCACTGTTTGCTTTGGACTCCTAACTTTGTTATCCGTGTTGAGTTTTTTACAATCTGTGCATGGACGACCATATCTTACCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--><------------------------------------------------------------------------------------------------
Q--G--N--E--I--F--P--D--K--K--Y--T--N--R--E--E--L--L--L--A--L--L--N--K--N--F--D--F--Q--R--P--F--N--T
AAGGAAATGAAATATTTCCAGATAAAAAATATACAAATCGTGAGGAACTATTGCTGGCTCTACTGAATAAAAATTTTGATTTCCAAAGACCTTTCAACAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-><------------------------------------><-----------------------------------------------------------
--D--L--A--L--P--N--K--L--E--E--L--N--Q--L--E--K--L--K--E--Q--L--V--E--E--K--D--S--E--T--S--Y--A--V-
TGACCTAGCCTTACCTAACAAACTGGAAGAACTTAACCAGCTGGAAAAGCTAAAAGAACAGCTAGTGGAGGAGAAGGATTCTGAGACGTCCTATGCTGTA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------><------------------------>
-D--G--L--F--S--S--H--P--S--K--R--A--C--F--W--K--Y--C--V--*-
GATGGTCTATTCTCTTCTCATCCTAGCAAACGAGCTTGCTTTTGGAAATACTGTGTTTAA
                                                            
------------------------------------------------------------
------------------------------------------------------------