Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000189178 (click for geneview)
Transcript ID ENST00000340589(link to ensembl)
Localtion Chromosome:14:65416063:65417529:-1 band: 14q23.3
Description  
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-Q--N--K--A--L--A--N--Q--V--S--V--C--L--E--R--L--G--S--L--T--F--K--P--E--Y--S--T--V--L--L--F--E--A--
CAAAACAAAGCTCTAGCCAATCAAGTCTCTGTGTGCCTGGAGAGACTGGGCAGTTTGACCTTTAAGCCTGAATATTCAACTGTCCTACTCTTTGAAGCAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
D--T--T--A--L--H--Q--T--I--T--T--F--V--S--L--K--T--I--Q--I--P--E--H--L--M--D--H--A--S--S--S--N--I--G
ACACAACTGCTCTGCATCAGACCATCACCACATTTGTGTCTCTCAAAACCATTCAAATTCCTGAGCACTTGATGGATCATGCTAGTTCATCAAATATTGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--P--F--L--K--K--R--G--Y--I--P--M--Q--E--Q--N--P--A--S--Q--L--F--L--S--A--N--G--S--L--E--T--N--L--P-
GCCTTTCCTGAAGAAAAGAGGCTATATCCCAATGCAAGAGCAGAATCCAGCATCACAACTGTTCCTCTCAGCAAATGGCTCCTTGGAAACAAATCTGCCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------------------------------------------><---------------------------------
-V--I--V--W--T--D--S--P--K--S--R--P--W--R--I--V--R--L--L--Q--E--P--N--F--F--S--S--V--W--E--N--L--K--
GTGATTGTCTGGACTGACTCACCCAAAAGCAGACCTTGGAGAATAGTCAGACTTCTGCAAGAGCCTAATTTCTTCAGTAGTGTCTGGGAAAACCTAAAGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------><---------------------------------------------------------------------------
G--L--E--N--W--L--L--K--I--P--E--K--P--S--Y--Q--K--C--N--S--H--S--T--T--S--S--F--S--I--E--T--E--D--Q
GCTTAGAAAACTGGCTCCTCAAGATTCCTGAAAAACCAAGTTATCAAAAGTGTAACAGCCATTCCACTACCAGTTCTTTCTCCATTGAAACTGAAGATCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------------------------><-----------------------------------------------
--E--F--P--E--Q--D--E--T--D--L--S--D--W--L--V--T--P--R--N--P--R--S--W--R--S--L--R--M--A--V--V--K--P-
AGAGTTTCCTGAACAAGATGAGACAGATCTATCAGATTGGTTGGTGACTCCCAGGAACCCCAGAAGCTGGAGAAGCCTGAGAATGGCAGTCGTGAAACCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------><------------------------------------------------------------------------------
-V--R--S--L--S--T--C--S--Y--N--V--N--D--W--L--V--K--T--N--S--R--T--N--C--Q--G--N--K--P--K--G--V--E--
GTGAGAAGTTTAAGCACTTGTTCCTACAATGTGAACGATTGGCTTGTCAAGACCAACTCCCGCACCAACTGTCAGGGCAACAAGCCCAAGGGGGTGGAGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------><----------------><-------------------------------------------------------------------
I--E--N--L--A--L--N--C--L--N--D--L--G--G--Q--N--T--I--V--H--P--Q--R--G--Y--W--D--W--P--V--Q--K--H--H
TTGAAAACCTGGCACTGAACTGCCTGAATGACCTTGGAGGCCAAAACACCATTGTCCACCCCCAGCGTGGTTACTGGGATTGGCCTGTCCAGAAGCATCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--D--P--C--K--V--E--E--M--C--K--A--N--E--P--C--T--S--F--A--K--C--V--C--D--E--N--C--E--K--E--A--L--C-
TGACCCATGTAAGGTAGAGGAGATGTGCAAAGCCAATGAGCCCTGCACAAGCTTTGCAAAGTGTGTGTGTGATGAGAATTGTGAGAAGGAAGCTCTGTGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-K--W--L--L--K--K--E--G--K--D--K--N--G--M--P--E--E--P--K--P--E--P--E--K--H--K--D--S--L--N--M--W--F--
AAGTGGCTTCTGAAGAAAGAAGGAAAGGATAAAAATGGGATGCCTGAGGAACCCAAACCTGAGCCTGAGAAGCATAAAGATTCCCTGAACATGTGGTTCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------><----------------------------------------><----------------------------------------
C--P--S--R--K--E--K--R--T--Q--A--L--K--V--M--V--P--S--G--T--F--L--P--S--H--K--E--Q--L--S--E--W--L--I
GTCCTTCTAGAAAAGAAAAGAGAACACAGGCACTAAAGGTAATGGTTCCTTCTGGAACTTTCCTTCCAAGTCATAAAGAACAGCTGTCAGAGTGGCTCAT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--W--P--P--Y--K--K--G--S--P--K--E--D--R--A--G--K--P--K--P--K--S--P--M--T--T--S--W--C--P--F--N--T--A-
CTGGCCGCCATACAAAAAAGGAAGTCCCAAGGAAGACAGAGCTGGCAAACCAAAGCCTAAAAGCCCCATGACCACTTCCTGGTGTCCCTTTAACACAGCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-D--W--V--L--P--G--Q--K--M--G--N--L--S--Q--L--S--S--V--K--D--K--W--L--L--G--K--K--A--Q--E--V--L--I--
GACTGGGTCCTGCCAGGACAGAAGATGGGCAACCTCAGCCAGTTATCCTCTGTCAAAGACAAGTGGCTGCTTGGAAAGAAGGCCCAGGAAGTATTAATTA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------------------------------------------------><-------------
N--S--P--L--Q--E--E--Y--N--F--L--L--D--L--F--G--L--P--A--V--C--D--L--F--A--C--M--Q--L--V--D--K--E--K
ATTCACCTCTACAGGAGGAATATAATTTCCTCCTAGACCTTTTCGGCCTCCCTGCAGTTTGTGACCTTTTTGCCTGTATGCAGCTTGTTGATAAAGAGAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------>
--W--L--H--Q--T--P--L--Q--M--*-
GTGGTTACACCAAACTCCTCTGCAGATGTGA
                               
-------------------------------
-------------------------------