Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000188023 (click for geneview)
Transcript ID ENST00000340753(link to ensembl)
Symbol Q7Z766_HUMAN
Localtion Chromosome:1:90171173:90171538:-1 band: 1p22.2
Description LOC492303 protein.
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--E--T--E--S--D--A--E--V--A--C--D--L--S--N--M--E--I--T--E--E--L--R--Q--Y--F--A--E--T--E--R--H--R--
ATGGAGACCGAGTCAGATGCAGAGGTAGCATGTGACCTGAGCAATATGGAAATCACCGAAGAGCTCCGCCAGTACTTTGCAGAGACAGAGAGGCACAGAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
E--E--L--L--R--R--Q--Q--L--D--A--E--R--L--N--S--Y--V--N--A--E--H--D--L--Y--C--N--T--R--R--S--V--E--A
AAGAACTACTGCGGCGGCAACAGCTGGATGCGGAGCGCCTGAACAGCTACGTGAACGCTGAACACGACCTGTACTGCAACACCCGCCGGTCGGTAGAGGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--P--A--E--R--P--G--E--R--R--Q--A--E--M--K--R--L--Y--W--D--S--A--A--K--I--Q--A--M--E--A--N--V--Q--L-
CCCAGCTGAGAGGCCTGGTGAGCGGCGCCAGGCCGAAATGAAGCGTTTGTACTGGGACAGCGCCGCCAAGATCCAGGCCATGGAGGCTAACGTGCAGCTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------->
-S--F--D--K--H--C--D--P--K--Q--P--N--Y--W--P--V--I--P--P--K--F--*-
AGCTTTGACAAGCACTGTGATCCAAAGCAGCCTAATTACTGGCCGGTCATCCCCCCGAAGTTCTGA
                                                                  
------------------------------------------------------------------
------------------------------------------------------------------