Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000188101 (click for geneview)
Transcript ID ENST00000340858(link to ensembl)
Localtion Chromosome:17:6502549:6502957:1 band: 17p13.1
Description  
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<-----------------------------------------------><--------------------------------------------------
-M--N--D--F--N--Q--I--F--C--C--G--Q--S--K--L--A--E--R--V--R--D--S--W--K--E--D--A--L--F--G--Y--Q--F--
CTGAATGACTTCAACCAGATTTTCTGCTGTGGCCAGAGCAAGCTGGCTGAGCGCGTGCGGGACTCCTGGAAGGAAGATGCCTTATTTGGGTACCAGTTTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
L--N--G--A--N--P--V--V--L--R--R--S--A--H--L--P--A--R--L--V--F--P--P--G--M--E--E--L--Q--A--Q--L--E--K
TTAATGGCGCCAACCCCGTGGTGCTGAGGCGCTCTGCTCACCTTCCTGCTCGCCTAGTGTTCCCTCCAGGCATGGAGGAACTGCAGGCCCAGCTGGAGAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------->
--E--L--E-
GGAGCTGGAG
          
----------
----------