Sequences
EST Library Info
nmm2Newborn 115 days, mucosal membranes
Clusters
Oligos
SNPs

Gene ID ENSG00000188984 (click for geneview)
Transcript ID ENST00000341434(link to ensembl)
Symbol NP_001013652.1
Localtion Chromosome:1:12638853:12660868:1 band: 1p36.21
Description Novel protein similar to esterases.
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-L--L--L--A--L--P--I--F--F--L--G--V--F--V--W--A--V--F--E--H--F--L--T--T--D--I--P--A--T--L--Q--H--P--
CTACTCTTGGCATTGCCCATCTTTTTCCTGGGGGTCTTTGTCTGGGCTGTCTTTGAGCACTTCCTCACCACGGATATCCCTGCTACCTTGCAGCATCCTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------><----------------------------------------------------
A--K--L--R--F--L--H--C--I--F--L--Y--L--V--T--L--G--N--I--F--E--K--L--G--I--C--S--M--P--K--F--I--R--F
CCAAGTTGAGATTCCTGCATTGCATATTCCTCTACCTGGTCACTTTGGGGAATATATTTGAGAAGCTGGGAATTTGCTCCATGCCCAAATTTATTCGTTT
                                               ::.:::::: ..::::::.:::::::::::::::::::::..:::::.:. ::
-----------------------------------------------GGAAATATAACCGAGAAGTTGGGAATTTGCTCCATGCCCAGGTTTATCCAGTT
------------------------------------------------G--N--I--T--E--K--L--G--I--C--S--M--P--R--F--I--Q--F

----------------------------------------------------------------------------------------------------
--L--H--D--S--V--R--I--K--K--D--P--E--L--V--V--T--D--L--R--F--G--T--I--P--V--R--L--F--Q--P--K--A--A-
TTTACATGATAGCGTGAGAATTAAAAAGGACCCTGAACTTGTGGTGACCGACCTGCGTTTTGGGACGATACCCGTGAGGCTGTTCCAGCCGAAGGCAGCA
:::.:: ::.: : :::::::.::.::::::: :..:::::::::.:::.::::::.::::::::: :::::::::::::::::.::::: : :::.:: 
TTTGCAAGACACCTTGAGAATCAAGAAGGACCATAGACTTGTGGTAACCAACCTGCATTTTGGGACCATACCCGTGAGGCTGTTTCAGCCCATGGCGGCC
--L--Q--D--T--L--R--I--K--K--D--H--R--L--V--V--T--N--L--H--F--G--T--I--P--V--R--L--F--Q--P--M--A--A-

---------------------------------------------------------------><-----------------------------------
-S--S--R--P--R--R--G--I--I--F--Y--H--G--G--A--T--V--F--G--S--L--D--C--Y--H--G--L--C--N--Y--L--A--R--
TCCTCCAGACCCCGGCGAGGCATCATCTTCTACCATGGAGGGGCCACAGTATTTGGGAGCCTGGATTGTTACCATGGCCTGTGCAATTATCTGGCCCGGG
:::.:::: ::::.::: ::: ::::::::: :::.::::::::: : :::: ::::::::::                                     
TCCCCCAGCCCCCAGCGTGGCTTCATCTTCTTCCACGGAGGGGCCTCCGTATGTGGGAGCCTG-------------------------------------
-S--P--S--P--Q--R--G--F--I--F--F--H--G--G--A--S--V--C--G--S--L--------------------------------------

---------------------------><-----------------------------------------------------------------------
E--T--E--S--V--L--L--M--I--G--Y--R--K--L--P--D--H--H--S--P--A--L--F--Q--D--C--M--N--A--S--I--H--F--L
AGACTGAATCTGTACTTCTGATGATTGGGTACCGCAAGCTTCCTGACCACCATTCCCCTGCCCTTTTCCAAGACTGCATGAATGCCTCCATTCACTTCCT
                             ::::::::::::::::::::::::  :::::.: ::::::...::::: ::::::::::::::::::::::
-----------------------------TACCGCAAGCTTCCTGACCACCATGACCCTGTCATTTTCCGGAACTGCCTGAATGCCTCCATTCACTTCCT
------------------------------Y--R--K--L--P--D--H--H--D--P--V--I--F--R--N--C--L--N--A--S--I--H--F--L

----------------------------------------------------------------------------------------------------
--K--A--L--E--T--Y--G--V--D--P--S--R--V--V--V--C--G--E--S--V--G--G--A--A--V--A--A--I--T--Q--A--L--V-
GAAGGCCCTGGAAACCTATGGGGTGGACCCCTCCAGGGTTGTGGTCTGTGGAGAAAGCGTCGGAGGTGCAGCGGTGGCCGCCATCACCCAGGCCTTGGTG
:.::::.:::::::::::.::::::::.:::::: :::: :::.:.:::::::: ::::: ::.:::: .   : :::: . ::: ::::::.:::::::
GGAGGCTCTGGAAACCTACGGGGTGGATCCCTCCCGGGTGGTGATTTGTGGAGACAGCGTAGGGGGTGGGTATGGGGCCTTGATCTCCCAGGTCTTGGTG
--E--A--L--E--T--Y--G--V--D--P--S--R--V--V--I--C--G--D--S--V--G--G--G--Y--G--A--L--I--S--Q--V--L--V-

----------------------------------------------------------------------------------------------------
-G--R--S--D--L--P--R--I--R--A--Q--V--L--I--Y--P--V--V--Q--A--F--C--L--Q--L--P--S--F--Q--Q--N--Q--N--
GGCAGATCAGATCTTCCCCGGATCCGGGCTCAGGTTCTGATTTATCCAGTTGTCCAGGCATTCTGTTTGCAGTTGCCATCCTTTCAGCAGAACCAAAATG
:::::::::::::::::.:::::::::::.:::::.::::::::::::::  ::::::.  :: .:::::::.::::::::: :::::::::::::::.:
GGCAGATCAGATCTTCCTCGGATCCGGGCCCAGGTCCTGATTTATCCAGTGCTCCAGGTCATCAATTTGCAGCTGCCATCCTATCAGCAGAACCAAAACG
-G--R--S--D--L--P--R--I--R--A--Q--V--L--I--Y--P--V--L--Q--V--I--N--L--Q--L--P--S--Y--Q--Q--N--Q--N--

----------------------------------------------------------------------------------------------------
V--P--L--L--S--R--K--F--M--V--T--S--L--C--N--Y--L--A--I--D--L--S--W--R--D--A--I--L--N--G--T--C--V--P
TCCCATTACTTTCCCGGAAGTTCATGGTGACTTCTCTGTGTAACTATCTGGCCATTGACCTCTCCTGGCGTGACGCCATCTTGAACGGCACTTGTGTACC
:::: :: ::.  ::.:::::: ::: :::::                                                                    
TCCCTTTCCTCAACCAGAAGTTGATGTTGACT--------------------------------------------------------------------
V--P--F--L--N--Q--K--L--M--L--T---------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--P--D--V--W--R--K--Y--E--K--W--L--S--P--D--N--I--P--K--K--F--K--N--R--G--Y--Q--P--W--S--P--G--P--F-
CCCAGACGTCTGGAGGAAGTACGAGAAGTGGCTCAGCCCTGACAACATCCCCAAGAAATTTAAGAACAGAGGCTACCAACCCTGGTCTCCCGGCCCTTTT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-N--E--A--A--Y--L--E--A--K--H--M--L--D--V--E--N--S--P--L--I--A--D--D--E--V--I--A--Q--L--P--E--A--F--
AATGAAGCTGCCTATCTAGAAGCCAAACATATGCTGGATGTAGAAAATTCACCCCTGATAGCAGATGATGAGGTCATCGCTCAGCTTCCTGAGGCCTTCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------------------------------->
L--V--S--C--E--N--D--I--L--R--D--D--S--L--L--Y--K--K--R--L-
TGGTGAGCTGTGAGAATGACATACTCCGTGATGACAGCTTGCTCTATAAGAAGCGCTTG
                                                           
-----------------------------------------------------------
-----------------------------------------------------------

Pig Consensus Sequence

>BGISUST0000878578
----------------------------------------------------------------------------------------------------
-----------------------------------------------GGAAATATAACCGAGAAGTTGGGAATTTGCTCCATGCCCAGGTTTATCCAGTT
TTTGCAAGACACCTTGAGAATCAAGAAGGACCATAGACTTGTGGTAACCAACCTGCATTTTGGGACCATACCCGTGAGGCTGTTTCAGCCCATGGCGGCC
TCCCCCAGCCCCCAGCGTGGCTTCATCTTCTTCCACGGAGGGGCCTCCGTATGTGGGAGCCTG-------------------------------------
-----------------------------TACCGCAAGCTTCCTGACCACCATGACCCTGTCATTTTCCGGAACTGCCTGAATGCCTCCATTCACTTCCT
GGAGGCTCTGGAAACCTACGGGGTGGATCCCTCCCGGGTGGTGATTTGTGGAGACAGCGTAGGGGGTGGGTATGGGGCCTTGATCTCCCAGGTCTTGGTG
GGCAGATCAGATCTTCCTCGGATCCGGGCCCAGGTCCTGATTTATCCAGTGCTCCAGGTCATCAATTTGCAGCTGCCATCCTATCAGCAGAACCAAAACG
TCCCTTTCCTCAACCAGAAGTTGATGTTGACT--------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
-----------------------------------------------------------


>BGISUSP0000878578
-------------------------------------------------GNITEKLGICSMPRFIQFLQDTLRIKKDHRLVVTNLHFGTIPVRLFQPMAA
SPSPQRGFIFFHGGASVCGSL----------------------YRKLPDHHDPVIFRNCLNASIHFLEALETYGVDPSRVVICGDSVGGGYGALISQVLV
GRSDLPRIRAQVLIYPVLQVINLQLPSYQQNQNVPFLNQKLMLT--------------------------------------------------------
-----------------------------------------------------