Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000187818 (click for geneview)
Transcript ID ENST00000341503(link to ensembl)
Localtion Chromosome:1:162976640:162978498:-1 band: 1q24.1
Description  
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-E--K--M--A--S--M--D--Y--S--T--Y--S--Q--A--A--A--Q--Q--G--Y--S--A--Y--N--T--Q--P--T--Q--G--Y--A--Q--
GAGAAAATGGCATCCATGGATTACAGTACCTATAGCCAAGCTGCAGCGCAGCAGGGCTACAGTGCTTACAACACCCAGCCCACTCAAGGATATGCACAGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
T--T--Q--A--Y--G--Q--Q--S--Y--G--T--Y--G--Q--P--I--D--V--S--Y--T--Q--A--Q--T--T--A--I--Y--G--Q--T--A
CCACCCAGGCATATGGGCAACAAAGCTATGGAACCTATGGACAGCCCATTGATGTCAGCTATACCCAGGCTCAGACCACTGCAATCTATGGGCAGACCGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--Y--A--T--S--Y--G--Q--P--P--T--G--Y--T--T--P--T--A--P--Q--A--Y--S--Q--P--V--Q--G--Y--G--T--G--A--Y-
CTATGCAACTTCTTATGGACAGCCTCCCACTGGTTATACTACTCCAACTGCCCCCCAGGCATACAGCCAGCCTGTCCAGGGGTATGGCACTGGTGCTTAT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-D--T--T--T--A--T--V--T--T--T--Q--A--S--Y--A--A--Q--S--A--Y--G--T--Q--P--A--Y--P--A--Y--G--Q--Q--P--
GATACCACCACTGCTACAGTCACCACCACCCAGGCCTCCTATGCAGCTCAATCTGCATATGGCACTCAGCCTGCTTATCCAGCTTATGGGCAGCAGCCAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
V--A--T--A--P--T--R--L--Q--N--G--N--K--P--T--E--T--S--Q--P--Q--S--S--T--G--G--Y--N--Q--P--S--L--G--Y
TAGCCACTGCACCTACAAGACTGCAGAATGGAAACAAGCCCACTGAGACTAGTCAACCTCAATCTAGCACAGGGGGTTACAACCAGCCCAGCCTAGGATA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--G--Q--S--N--C--S--Y--P--Q--V--P--G--S--Y--S--M--Q--P--V--T--A--P--P--S--Y--P--P--T--S--Y--S--S--T-
TGGACAGAGTAACTGCAGTTATCCCCAGGTACCTGGGAGCTACTCCATGCAGCCAGTCACCGCACCTCCATCCTACCCTCCTACCAGCTATTCCTCTACA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-Q--P--T--S--Y--D--Q--S--S--Y--S--Q--Q--N--T--Y--G--K--P--S--S--Y--G--Q--Q--S--S--Y--G--Q--Q--S--S--
CAGCCAACTAGTTATGATCAGAGCAGTTACTCTCAGCAGAACACCTATGGGAAACCGAGCAGCTATGGACAGCAGAGTAGCTATGGTCAACAAAGCAGCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------><><----------------------------------------------------------------------------
Y--G--Q--L--P--P--T--R--H--P--S--S--M--G--V--Y--G--Q--E--S--G--G--F--S--G--L--G--E--N--R--S--M--S--G
ATGGGCAGCTGCCTCCCACTAGACACCCCAGTAGCATGGGTGTTTATGGGCAGGAGTCTGGAGGATTTTCCGGACTAGGAGAGAACCGGAGCATGAGTGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--P--D--N--W--G--R--G--R--G--G--F--D--R--G--G--M--S--R--G--G--R--G--G--G--C--G--G--M--G--S--A--G--E-
CCCTGATAACTGGGGCAGGGGAAGAGGGGGATTTGATCGTGGAGGCATGAGCAGAGGTGGGCGGGGAGGAGGATGCGGTGGAATGGGCAGCGCTGGAGAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-Q--V--G--F--N--K--P--G--G--P--M--D--E--G--P--D--L--D--L--G--P--P--V--D--P--D--E--D--S--D--N--S--A--
CAAGTTGGCTTCAATAAGCCTGGTGGACCCATGGATGAAGGACCAGATCTTGATCTAGGCCCACCTGTAGATCCAGATGAAGACTCTGACAACAGTGCAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
I--Y--V--Q--G--L--N--D--N--V--T--L--D--D--L--V--D--F--F--K--Q--C--G--V--V--K--M--N--K--R--T--E--Q--P
TTTATGTACAAGGATTAAATGACAATGTGACTCTAGATGATCTGGTAGACTTCTTTAAGCAGTGTGGGGTTGTTAAGATGAACAAGAGAACTGAGCAACC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--M--I--H--T--Y--L--D--K--E--T--R--K--P--K--G--D--A--T--V--S--C--E--D--S--P--T--A--K--A--A--V--E--W-
CATGATCCACACCTACCTGGACAAGGAAACAAGAAAGCCCAAAGGTGATGCCACAGTGTCCTGTGAAGACTCACCTACTGCCAAAGCTGCCGTGGAATGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-F--D--G--K--D--F--Q--G--S--K--L--K--V--S--L--A--R--K--R--P--P--V--N--S--M--Q--G--G--M--P--P--H--E--
TTTGATGGGAAAGATTTTCAAGGGAGCAAACTTAAAGTCTCTCTTGCTCGGAAGAGGCCTCCAGTGAACAGTATGCAGGGTGGTATGCCACCCCATGAGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
G--R--G--M--P--P--P--L--C--G--G--P--G--G--P--G--S--P--G--G--P--M--G--H--M--G--G--R--G--G--D--R--G--G
GCAGAGGGATGCCACCACCACTCTGCGGAGGTCCAGGAGGCCCAGGAAGTCCTGGGGGACCCATGGGTCACATGGGAGGCCGTGGAGGAGATAGAGGAGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--L--P--P--R--G--P--Q--G--S--R--G--N--T--S--G--G--G--N--V--Q--H--Q--A--G--D--R--Q--C--P--N--P--G--C-
CCTCCCTCCAAGAGGACCCCAGGGTTCCCGAGGGAACACCTCTGGAGGAGGAAACGTCCAGCACCAAGCTGGAGACAGGCAGTGTCCCAATCCGGGTTGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-G--N--Q--N--F--A--W--R--T--E--S--N--K--C--K--A--P--K--P--E--G--F--L--P--P--P--F--P--P--P--G--G--D--
GGAAACCAGAACTTCGCCTGGAGAACAGAGAGCAACAAGTGTAAGGCTCCAAAGCCTGAAGGCTTCCTCCCGCCACCCTTCCCACCCCCGGGTGGTGATC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
H--G--R--G--G--P--G--G--M--W--G--G--R--G--G--L--M--D--H--G--G--P--G--G--M--F--R--G--G--C--G--R--D--R
ATGGCAGAGGTGGCCCTGGTGGCATGTGGGGAGGAAGAGGTGGCCTCATGGATCATGGTGGTCCCGGTGGAATGTTCAGAGGTGGCTGTGGTAGAGACAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------><------------------------------------------->
--S--G--F--C--G--G--M--D--R--G--G--F--G--G--G--R--Q--G--G--P-
AAGTGGCTTCTGTGGTGGCATGGACCGAGGTGGCTTTGGTGGAGGAAGACAAGGTGGCCCT
                                                             
-------------------------------------------------------------
-------------------------------------------------------------