Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000189233 (click for geneview)
Transcript ID ENST00000341513(link to ensembl)
Symbol Q6ZP73_HUMAN
Localtion Chromosome:8:27935646:27946989:-1 band: 8p21.1
Description PREDICTED: hypothetical protein XP_372035
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--P--H--I--D--A--F--K--Q--S--L--Q--E--K--M--T--E--I--G--I--R--S--G--W--K--Y--D--S--C--K--K--N--F--
ATGCCTCACATAGATGCTTTTAAGCAGTCCCTGCAGGAGAAAATGACAGAAATTGGGATAAGAAGTGGCTGGAAATATGATAGCTGCAAAAAAAATTTCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------><----------------------------------------------------------------------------------------
L--I--Q--E--I--S--A--I--L--G--G--L--E--D--H--I--L--R--R--K--R--R--I--Y--E--S--L--T--A--S--V--Q--S--D
TGATCCAGGAGATAAGTGCCATCCTCGGGGGCCTGGAGGACCACATCCTCAGAAGGAAGAGGAGGATCTACGAGTCCCTCACTGCCTCTGTCCAGAGTGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------><-------------------------------------------------------------------------------
--L--K--L--C--Y--E--E--A--A--Q--I--T--G--K--K--A--C--E--R--M--K--D--A--I--R--R--G--V--D--R--Q--V--A-
CCTGAAGCTCTGTTACGAAGAGGCAGCTCAGATCACGGGCAAAAAAGCGTGTGAGCGGATGAAAGATGCCATCAGAAGAGGAGTGGACCGGCAGGTGGCT
                      ::::::::::::::::::::::::::::::::. :.::::::::::.::::::::::::.::.:::::::::::::::
----------------------GCAGCTCAGATCACGGGCAAAAAAGCGTGTGAAAGAATGAAAGATGTCATCAGAAGAGGGGTAGACCGGCAGGTGGCT
-----------------------A--A--Q--I--T--G--K--K--A--C--E--R--M--K--D--V--I--R--R--G--V--D--R--Q--V--A-

--------------------------------------------------------><------------------------------------------
-E--G--M--F--E--R--A--Q--E--R--M--Q--H--Q--F--Q--Q--L--K--T--G--I--V--E--K--V--K--G--S--I--T--T--M--
GAGGGCATGTTTGAAAGGGCCCAGGAAAGGATGCAGCACCAGTTTCAGCAGCTGAAGACTGGAATCGTGGAGAAGGTGAAGGGCAGCATCACCACTATGC
:::::::::::.::::::::. :.:::::::::::::::::.:::::::::::::::   ::::::..:::::::::::::::::::::::::::.::::
GAGGGCATGTTCGAAAGGGCTGAAGAAAGGATGCAGCACCAATTTCAGCAGCTGAAG---GGAATCACGGAGAAGGTGAAGGGCAGCATCACCACCATGC
-E--G--M--F--E--R--A--E--E--R--M--Q--H--Q--F--Q--Q--L--K-----G--I--T--E--K--V--K--G--S--I--T--T--M--

-----------------------------------------------><---------------------------------------------------
L--A--L--A--S--S--Q--G--D--G--L--Y--K--E--L--A--D--V--G--S--E--Y--K--E--M--E--K--L--H--R--S--L--R--E
TGGCCCTTGCTTCGTCCCAGGGGGATGGCCTCTACAAGGAGCTTGCAGATGTCGGGAGTGAATACAAGGAGATGGAGAAGCTGCACAGAAGCCTGAGGGA
::.::::::::::::::::::::::::: ::::::::::::::::::   :::...:::::::::::.::::::::::::::::::::.:::::::.:::
TGACCCTTGCTTCGTCCCAGGGGGATGGACTCTACAAGGAGCTTGCA---GTCAAAAGTGAATACAAAGAGATGGAGAAGCTGCACAGGAGCCTGAAGGA
L--T--L--A--S--S--Q--G--D--G--L--Y--K--E--L--A-----V--K--S--E--Y--K--E--M--E--K--L--H--R--S--L--K--E

--------------------------------------------------------------------------------------------->
--V--A--E--N--A--R--L--R--K--G--M--Q--E--F--L--L--R--A--S--P--S--K--A--G--P--P--G--T--S--L--*-
GGTCGCGGAGAATGCACGGCTGAGGAAGGGCATGCAAGAATTCCTCCTAAGGGCATCCCCCAGCAAGGCTGGCCCCCCCGGGACATCACTGTAA
::: ::::::::::::  :::: :::.:::::::::::: :::::.::.::....:::::::::::.::::: :::::. ..:::         
GGTAGCGGAGAATGCAGTGCTGCGGAGGGGCATGCAAGATTTCCTTCTGAGAATGTCCCCCAGCAAAGCTGGGCCCCCTCAAACA---------
--V--A--E--N--A--V--L--R--R--G--M--Q--D--F--L--L--R--M--S--P--S--K--A--G--P--P--Q--T----------

Pig Consensus Sequence

>BGISUST0000882680
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------GCAGCTCAGATCACGGGCAAAAAAGCGTGTGAAAGAATGAAAGATGTCATCAGAAGAGGGGTAGACCGGCAGGTGGCT
GAGGGCATGTTCGAAAGGGCTGAAGAAAGGATGCAGCACCAATTTCAGCAGCTGAAG---GGAATCACGGAGAAGGTGAAGGGCAGCATCACCACCATGC
TGACCCTTGCTTCGTCCCAGGGGGATGGACTCTACAAGGAGCTTGCA---GTCAAAAGTGAATACAAAGAGATGGAGAAGCTGCACAGGAGCCTGAAGGA
GGTAGCGGAGAATGCAGTGCTGCGGAGGGGCATGCAAGATTTCCTTCTGAGAATGTCCCCCAGCAAAGCTGGGCCCCCTCAAACA---------


>BGISUSP0000882680
--------------------------------------------------------------------------AAQITGKKACERMKDVIRRGVDRQVA
EGMFERAEERMQHQFQQLK-GITEKVKGSITTMLTLASSQGDGLYKELA-VKSEYKEMEKLHRSLKEVAENAVLRRGMQDFLLRMSPSKAGPPQT---