Sequences
EST Library Info
hea2Heart
Clusters
Oligos
SNPs

Gene ID ENSG00000187824 (click for geneview)
Transcript ID ENST00000341871(link to ensembl)
Symbol NP_001004313.1
Localtion Chromosome:17:10557337:10574371:-1 band: 17p13.1
Description similar to RIKEN cDNA A730055C05 gene
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<----------------------------------------------------------------------><---------------------------
-M--A--P--A--L--W--R--A--C--N--G--L--M--A--A--F--F--A--L--A--A--L--V--Q--V--N--D--P--D--A--E--V--W--
ATGGCGCCAGCGCTGTGGCGGGCCTGCAACGGACTCATGGCCGCCTTCTTCGCGCTGGCGGCCTTGGTGCAGGTAAATGACCCAGATGCAGAGGTGTGGG
   :::: .:. :::::::: ::::::::: :.:: :::: ::::::::::::::::::.::::: ::::::                            
---GCGCAGGTCCTGTGGCGCGCCTGCAACTGGCTGATGGGCGCCTTCTTCGCGCTGGCAGCCTTCGTGCAG----------------------------
----A--Q--V--L--W--R--A--C--N--W--L--M--G--A--F--F--A--L--A--A--F--V--Q-----------------------------

-><-----------------------------------------------------------><------------------------------------
V--V--V--Y--T--I--P--A--V--L--T--L--L--V--G--L--N--P--E--V--T--G--N--V--I--W--K--S--I--S--A--I--H--I
TGGTGGTGTACACAATCCCTGCAGTACTGACCCTGCTTGTTGGACTTAACCCTGAAGTCACAGGTAATGTTATTTGGAAAAGTATCTCTGCAATACACAT
  :: :::::.::.::.::::: : .::::::::::: :::::::::::::::   ::::::                                      
--GTTGTGTATACGATTCCTGCCGGGCTGACCCTGCTGGTTGGACTTAACCCTCTTGTCACA--------------------------------------
---V--V--Y--T--I--P--A--G--L--T--L--L--V--G--L--N--P--L--V--T---------------------------------------

--------------------------------------------------------------------------------------><------------
--L--F--C--T--V--W--A--V--G--L--A--S--Y--L--L--H--R--T--Q--Q--N--I--L--H--E--E--E--G--R--E--L--S--G-
ACTCTTTTGTACGGTGTGGGCTGTTGGCTTGGCGTCCTACCTCTTGCATCGTACACAACAGAACATCTTACATGAGGAAGAAGGCAGGGAGCTGTCTGGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------><----------------------------------------------------
-L--V--I--I--T--A--W--I--I--L--C--H--S--S--S--K--N--P--V--G--G--R--I--Q--L--A--I--A--I--V--I--T--L--
CTGGTGATTATTACAGCATGGATTATCCTGTGCCACAGTTCCTCAAAGAATCCAGTTGGTGGAAGAATTCAATTGGCTATTGCCATTGTAATCACACTTT
                                                :::::::.::::::::::::::. :::::.:::::.::.:.:.:..: ::::
------------------------------------------------AATCCAGCTGGTGGAAGAATTCGCTTGGCCATTGCTATCGCAGTTGCTCTTT
-------------------------------------------------N--P--A--G--G--R--I--R--L--A--I--A--I--A--V--A--L--

---------------------------------------------------------------------------------->
F--P--F--I--S--W--V--Y--I--Y--I--N--K--E--M--R--S--S--W--P--T--H--C--K--T--V--I--*-
TCCCATTTATCTCATGGGTCTACATATATATTAACAAGGAAATGCGGTCCTCTTGGCCAACTCACTGCAAGACAGTAATTTAA
::::::::::::::::::::::::::::..:.::::::::.:::::::::::.::::::.:::::::::::::::: ::::::
TCCCATTTATCTCATGGGTCTACATATACGTCAACAAGGAGATGCGGTCCTCCTGGCCAGCTCACTGCAAGACAGTCATTTAA
F--P--F--I--S--W--V--Y--I--Y--V--N--K--E--M--R--S--S--W--P--A--H--C--K--T--V--I--*-

Pig Consensus Sequence

>BGISUST0000881197
---GCGCAGGTCCTGTGGCGCGCCTGCAACTGGCTGATGGGCGCCTTCTTCGCGCTGGCAGCCTTCGTGCAG----------------------------
--GTTGTGTATACGATTCCTGCCGGGCTGACCCTGCTGGTTGGACTTAACCCTCTTGTCACA--------------------------------------
----------------------------------------------------------------------------------------------------
------------------------------------------------AATCCAGCTGGTGGAAGAATTCGCTTGGCCATTGCTATCGCAGTTGCTCTTT
TCCCATTTATCTCATGGGTCTACATATACGTCAACAAGGAGATGCGGTCCTCCTGGCCAGCTCACTGCAAGACAGTCATTTAA


>BGISUSP0000881197
-AQVLWRACNWLMGAFFALAAFVQ----------VVYTIPAGLTLLVGLNPLVT----------------------------------------------
----------------NPAGGRIRLAIAIAVALFPFISWVYIYVNKEMRSSWPAHCKTVI*