Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000188322 (click for geneview)
Transcript ID ENST00000341901(link to ensembl)
Localtion Chromosome:16:28236214:28239743:1 band: 16p11.2
Description  
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--S--V--G--C--P--E--P--E--P--P--R--S--L--T--C--C--G--P--G--T--A--P--G--P--G--A--G--V--P--L--L--T--
ATGAGCGTGGGCTGCCCAGAGCCTGAGCCGCCCCGCTCCCTGACCTGCTGTGGGCCGGGGACTGCCCCTGGGCCTGGTGCCGGTGTGCCCCTTCTCACTG
::::::::::::  :::.:::::.::::::::::.::::::: :::::::::::::::::::.::::::::::. ::::: ::.::::::::.:::::::
ATGAGCGTGGGCGTCCCGGAGCCCGAGCCGCCCCACTCCCTGCCCTGCTGTGGGCCGGGGACCGCCCCTGGGCTGGGTGCAGGCGTGCCCCTCCTCACTG
-M--S--V--G--V--P--E--P--E--P--P--H--S--L--P--C--C--G--P--G--T--A--P--G--L--G--A--G--V--P--L--L--T--

----------------------------------------------------------------------------------------------------
E--D--M--Q--A--L--T--L--R--T--L--A--A--S--D--V--T--K--H--Y--E--L--V--R--E--L--G--K--G--T--Y--G--K--V
AAGACATGCAGGCCCTGACTCTCCGCACACTGGCCGCCAGCGACGTCACCAAGCACTACGAACTAGTCCGGGAGCTGGGCAAAGGCACCTATGGGAAGGT
:::::::::::::::::::.::::::::::::::::: ::.::::::::::::::::::::::: :::::::::::::::::.:::::::::::::::::
AAGACATGCAGGCCCTGACCCTCCGCACACTGGCCGCAAGTGACGTCACCAAGCACTACGAACTCGTCCGGGAGCTGGGCAAGGGCACCTATGGGAAGGT
E--D--M--Q--A--L--T--L--R--T--L--A--A--S--D--V--T--K--H--Y--E--L--V--R--E--L--G--K--G--T--Y--G--K--V

-------------------------><-------------------------------------------------------------------------
--D--L--V--V--Y--K--G--T--G--T--K--M--A--L--K--F--V--N--K--S--K--T--K--L--K--N--F--L--R--E--V--S--I-
TGACCTGGTGGTCTACAAGGGCACAGGCACAAAAATGGCACTGAAGTTTGTGAACAAGAGCAAAACCAAGCTGAAGAACTTCCTACGGGAGGTGAGCATC
.::::::::.:.:::::::::::::                                                                           
CGACCTGGTAGCCTACAAGGGCACA---------------------------------------------------------------------------
--D--L--V--A--Y--K--G--T----------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-T--N--S--L--S--S--S--P--F--I--I--K--V--F--D--V--V--F--E--T--E--D--C--Y--V--F--A--Q--E--Y--A--P--A--
ACCAACAGCCTCTCCTCCAGCCCCTTCATCATCAAGGTCTTTGACGTGGTCTTTGAGACAGAGGACTGCTACGTCTTTGCCCAGGAGTACGCACCTGCTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------><----------------------------------------------------------------------
G--D--L--F--D--I--I--P--P--Q--V--G--L--P--E--D--T--V--K--R--C--V--Q--Q--L--G--L--A--L--D--F--M--H--G
GGGACCTGTTTGACATCATCCCTCCCCAGGTGGGGCTCCCTGAGGACACGGTGAAGCGCTGTGTGCAGCAGCTGGGCCTGGCGCTGGACTTCATGCACGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--R--Q--L--V--H--R--D--I--K--P--E--N--V--L--L--F--D--R--E--C--R--R--V--K--L--A--D--F--G--M--T--R--R-
GCGGCAGCTGGTGCACCGCGACATCAAGCCCGAGAACGTGCTGCTGTTCGACCGCGAGTGCCGCCGCGTAAAGCTGGCCGACTTCGGCATGACGCGCCGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-V--G--C--R--V--K--R--V--S--G--T--I--P--Y--T--A--P--E--V--C--Q--A--G--R--A--D--G--L--A--V--D--T--G--
GTGGGCTGCCGCGTCAAGCGCGTGAGCGGCACCATCCCTTACACGGCGCCTGAGGTGTGCCAGGCGGGCCGCGCCGACGGGCTGGCGGTGGACACGGGCG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
V--D--V--W--A--F--G--V--L--I--F--C--V--L--T--G--N--F--P--W--E--A--A--S--G--A--D--A--F--F--E--E--F--V
TGGACGTGTGGGCCTTCGGCGTGCTCATCTTCTGCGTGCTCACCGGCAACTTCCCGTGGGAGGCGGCGTCGGGCGCCGACGCCTTCTTCGAGGAGTTCGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--R--W--Q--R--G--R--L--P--G--L--P--S--Q--W--R--R--F--T--E--P--A--L--R--M--F--Q--R--L--L--A--L--E--P-
GCGCTGGCAGCGGGGCCGCCTGCCGGGGCTGCCTTCGCAGTGGCGCCGCTTCACCGAGCCCGCGCTGCGCATGTTCCAGCGCTTACTGGCCCTGGAGCCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------><----------------------------------------------
-E--R--R--G--P--A--K--E--V--F--R--F--L--K--H--E--L--T--L--R--L--E--A--P--G--P--L--K--R--T--V--L--T--
GAGCGCCGCGGCCCAGCCAAGGAGGTGTTCCGCTTCCTCAAGCACGAGCTCACACTGCGCCTCGAGGCGCCTGGGCCGCTCAAGCGGACGGTGCTGACCG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
E--S--G--S--G--S--R--P--A--P--P--A--V--G--S--V--P--L--P--V--P--V--P--V--P--V--P--V--P--V--P--V--P--E
AGAGCGGCAGCGGCTCCCGGCCCGCGCCCCCCGCCGTCGGGTCGGTGCCCTTGCCCGTGCCGGTGCCGGTGCCAGTGCCCGTGCCGGTGCCTGTGCCCGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--P--G--L--A--P--Q--G--P--P--G--R--T--D--G--R--A--D--K--S--K--G--Q--V--V--L--A--T--A--I--E--I--C--V-
GCCCGGCCTAGCTCCCCAGGGGCCCCCCGGCCGGACCGACGGCCGCGCGGACAAGAGCAAAGGGCAGGTGGTGCTGGCCACGGCCATCGAGATCTGCGTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-->
-*-
TGA
   
---
---

Pig Consensus Sequence

>BGISUST0000890805
ATGAGCGTGGGCGTCCCGGAGCCCGAGCCGCCCCACTCCCTGCCCTGCTGTGGGCCGGGGACCGCCCCTGGGCTGGGTGCAGGCGTGCCCCTCCTCACTG
AAGACATGCAGGCCCTGACCCTCCGCACACTGGCCGCAAGTGACGTCACCAAGCACTACGAACTCGTCCGGGAGCTGGGCAAGGGCACCTATGGGAAGGT
CGACCTGGTAGCCTACAAGGGCACA---------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
---


>BGISUSP0000890805
MSVGVPEPEPPHSLPCCGPGTAPGLGAGVPLLTEDMQALTLRTLAASDVTKHYELVRELGKGTYGKVDLVAYKGT-------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
-