Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000188265 (click for geneview)
Transcript ID ENST00000342036(link to ensembl)
Localtion Chromosome:17:10669274:10669681:-1 band: 17p13.1
Description  
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--E--T--L--P--K--V--L--E--V--D--E--K--S--P--E--A--K--D--L--L--P--S--Q--T--A--S--S--L--C--I--S--S--
ATGGAGACTCTCCCCAAGGTTCTAGAGGTCGATGAGAAGTCTCCAGAAGCCAAGGACCTGCTGCCCAGCCAGACCGCCAGCTCCCTGTGCATCAGCTCCA
                                             ::: ::::::::::::::::::::::::: :::::::: ::::::::::::::::
---------------------------------------------GAATCCAAGGACCTGCTGCCCAGCCAGACGGCCAGCTCGCTGTGCATCAGCTCCA
----------------------------------------------E--S--K--D--L--L--P--S--Q--T--A--S--S--L--C--I--S--S--

----------------------------------------------------------------------------------------------------
R--S--E--S--V--W--T--T--T--P--R--S--N--W--E--I--Y--R--K--P--I--V--I--M--S--V--G--G--A--I--L--L--F--G
GGAGCGAGTCTGTCTGGACCACCACCCCCAGGAGTAACTGGGAAATCTACCGCAAGCCCATCGTTATCATGTCAGTGGGCGGTGCCATCCTGCTTTTCGG
:.:::::::::::::::::::::.::::::::::::.::::::.:::::::::::::::..:::.:::::::: ::::::::.:::::::: ::.:::::
GAAGCGAGTCTGTCTGGACCACCGCCCCCAGGAGTAGCTGGGAGATCTACCGCAAGCCCGCCGTCATCATGTCCGTGGGCGGCGCCATCCTCCTCTTCGG
R--S--E--S--V--W--T--T--A--P--R--S--S--W--E--I--Y--R--K--P--A--V--I--M--S--V--G--G--A--I--L--L--F--G

----------------------------------------------------------------------------------------------------
--V--V--I--T--C--L--A--Y--T--L--K--L--S--D--K--S--L--S--I--L--K--M--V--G--P--G--F--L--S--L--G--L--M-
CGTGGTCATCACCTGCTTGGCCTACACCTTGAAGCTGAGTGACAAGAGTCTCTCCATCCTCAAAATGGTAGGGCCTGGCTTCCTGTCCCTGGGACTCATG
::::::: ::::::::::::::::::::.::: .:::.::.:::::::.::    .:::: ::.:::...::::::: :::::::::.::::::::::::
CGTGGTCCTCACCTGCTTGGCCTACACCCTGACACTGGGTAACAAGAGCCTGGAGGTCCTGAAGATGACGGGGCCTGCCTTCCTGTCTCTGGGACTCATG
--V--V--L--T--C--L--A--Y--T--L--T--L--G--N--K--S--L--E--V--L--K--M--T--G--P--A--F--L--S--L--G--L--M-

----------------------------------------------------------------------------------------------------
-M--L--V--C--G--L--V--W--V--P--I--I--K--K--K--Q--K--H--R--Q--K--S--N--F--L--R--S--L--K--S--F--F--L--
ATGCTGGTGTGCGGGCTGGTGTGGGTGCCCATCATCAAAAAGAAACAGAAGCACAGACAGAAGTCGAATTTCTTACGCAGCCTCAAGTCCTTCTTCCTGA
:::::::::::::::                                                                                     
ATGCTGGTGTGCGGG-------------------------------------------------------------------------------------
-M--L--V--C--G--------------------------------------------------------------------------------------

------->
T--R--*-
CTCGCTGA
        
--------
--------

Pig Consensus Sequence

>BGISUST0000884763
---------------------------------------------GAATCCAAGGACCTGCTGCCCAGCCAGACGGCCAGCTCGCTGTGCATCAGCTCCA
GAAGCGAGTCTGTCTGGACCACCGCCCCCAGGAGTAGCTGGGAGATCTACCGCAAGCCCGCCGTCATCATGTCCGTGGGCGGCGCCATCCTCCTCTTCGG
CGTGGTCCTCACCTGCTTGGCCTACACCCTGACACTGGGTAACAAGAGCCTGGAGGTCCTGAAGATGACGGGGCCTGCCTTCCTGTCTCTGGGACTCATG
ATGCTGGTGTGCGGG-------------------------------------------------------------------------------------
--------


>BGISUSP0000884763
---------------ESKDLLPSQTASSLCISSRSESVWTTAPRSSWEIYRKPAVIMSVGGAILLFGVVLTCLAYTLTLGNKSLEVLKMTGPAFLSLGLM
MLVCG-------------------------------