Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000188443 (click for geneview)
Transcript ID ENST00000342919(link to ensembl)
Localtion Chromosome:16:33568872:33660229:-1 band: 16p11.2
Description  
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<-----------------------------------------------------------------------------------------><--------
-E--V--Q--L--V--E--S--G--G--G--L--V--Q--P--G--G--S--L--R--H--S--C--A--A--S--G--F--T--F--S--S--G--F--
GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTCCAGCCTGGGGGGTCCCTGAGACACTCCTGTGCAGCCTCTGGATTCACCTTCAGCTCTGGATTCA
:::: ::::::::::::::::::.::::::.:::: :::::::  :::::.::::::: ::::::::::: ::::::.:::::::::             
GAGGGGCAGCTGGTGGAGTCTGGAGGAGGCCTGGTGCAGCCTGT-GGGTCTCTGAGACTCTCCTGTGCAGACTCTGGGTTCACCTTC-------------
-E--G--Q--L--V--E--S--G--G--G--L--V--Q--P--G--G--S--L--R--L--S--C--A--D--S--G--F--T--F--------------

----------------------------------------------------------------------------------------------------
T--F--S--S--Y--A--M--H--W--V--R--Q--A--P--G--K--G--L--E--W--V--S--A--I--G--A--G--G--G--T--Y--Y--A--D
CCTTCAGTAGCTATGCTATGCACTGGGTTCGCCAGGCTCCAGGAAAAGGTCTGGAGTGGGTATCAGCTATTGGTGCTGGTGGTGGCACATACTATGCAGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--S--V--K--G--R--F--T--I--S--R--D--N--A--K--N--S--L--Y--L--Q--M--N--S--L--R--A--E--D--M--A--V--Y--Y-
CTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATGCCAAGAACTCCTTGTATCTTCAAATGAACAGCCTGAGAGCCGAGGACATGGCTGTGTATTAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---
-C-
TGT
   
---
---

Pig Consensus Sequence

>BGISUST0000878560
GAGGGGCAGCTGGTGGAGTCTGGAGGAGGCCTGGTGCAGCCtgGGTCTCTGAGACTCTCCTGTGCAGACTCTGGGTTCACCTTC----------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------


>BGISUSP0000878560
EGQLVESGGGLVQPGSLRLSCADSGFTF------------------------------------------------------------------------