Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000188985 (click for geneview)
Transcript ID ENST00000342938(link to ensembl)
Symbol DHFR
Localtion Chromosome:18:22004685:22005248:-1 band: 18q11.2
Description Dihydrofolate reductase (EC 1.5.1.3). [Source:Uniprot/SWISSPROT;Acc:P00374]
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--V--G--S--L--N--C--I--V--A--V--S--Q--N--M--G--I--G--K--N--G--D--L--P--W--P--P--L--R--N--E--F--R--
ATGGTTGGTTCGCTAAACTGCATCGTCGCTGTGTCCCAGAACATGGGCATCGGCAAGAACGGGGACCTGCCCTGGCCACCGCTCAGGAATGAATTCAGAT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
Y--F--Q--R--M--T--T--T--S--S--V--E--G--K--Q--N--L--V--I--M--G--K--K--T--W--F--S--I--P--E--K--N--R--P
ATTTCCAGAGAATGACCACAACCTCTTCAGTAGAAGGTAAACAGAATCTGGTGATTATGGGTAAGAAGACCTGGTTCTCCATTCCTGAGAAGAATCGACC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--L--K--G--R--I--N--L--V--L--S--R--E--L--K--E--P--P--Q--G--A--H--F--L--S--R--S--L--D--D--A--L--K--L-
TTTAAAGGGTAGAATTAATTTAGTTCTCAGCAGAGAACTCAAGGAACCTCCACAAGGAGCTCATTTTCTTTCCAGAAGTCTAGATGATGCCTTAAAACTT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-T--E--Q--P--E--L--A--N--K--V--D--M--V--W--I--V--G--G--S--S--V--Y--K--E--A--M--N--H--P--G--H--L--K--
ACTGAACAACCAGAATTAGCAAATAAAGTAGACATGGTCTGGATAGTTGGTGGCAGTTCTGTTTATAAGGAAGCCATGAATCACCCAGGCCATCTTAAAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
L--F--V--T--R--I--M--Q--D--F--E--S--D--T--F--F--P--E--I--D--L--E--K--Y--K--L--L--P--E--Y--P--G--V--L
TATTTGTGACAAGGATCATGCAAGACTTTGAAAGTGACACGTTTTTTCCAGAAATTGATTTGGAGAAATATAAACTTCTGCCAGAATACCCAGGTGTTCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------------------->
--S--D--V--Q--E--E--K--G--I--K--Y--K--F--E--V--Y--E--K--N--D--*-
CTCTGATGTCCAGGAGGAGAAAGGCATTAAGTACAAATTTGAAGTATATGAGAAGAATGATTAA
                                                                
----------------------------------------------------------------
----------------------------------------------------------------