Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000096224 (click for geneview)
Transcript ID ENST00000342999(link to ensembl)
Symbol NP_009092.2
Localtion Chromosome:6:31661957:31664566:1 band: 6p21.33
Description leukocyte specific transcript 1 isoform 1
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<-----------------><--------------------------------------------------------------------------------
-M--L--S--R--N--D--D--I--C--I--Y--G--G--L--G--L--G--G--L--L--L--L--A--V--V--L--L--S--A--C--L--C--W--
ATGTTATCGCGGAATGATGATATATGTATCTACGGGGGCCTGGGGCTGGGCGGGCTCCTGCTTCTGGCAGTGGTCCTTCTGTCCGCCTGCCTGTGTTGGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------><---------------------><------><--------------------------------------------------------
L--H--R--R--V--K--R--L--E--R--S--W--W--L--T--P--R--A--P--Q--S--R--N--S--T--M--H--L--C--R--G--C--Q--C
TGCATCGAAGAGTAAAGAGGCTGGAGAGGAGCTGGTGGCTCACGCCCAGGGCTCCTCAGAGCAGGAACTCCACTATGCATCTCTGCAGAGGCTGCCAGTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--P--A--V--R--D--L--T--S--G--A--E--T--R--E--A--P--R--R--I--Q--E--L--T--M--P--A--L--L--R--T--N--P--P-
CCCAGCAGTGAGGGACCTGACCTCAGGGGCAGAGACAAGAGAGGCACCAAGGAGGATCCAAGAGCTGACTATGCCTGCATTGCTGAGAACAAACCCACCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------->
-E--H--P--R--H--L--P--Q--P--R--R--V--D--R--V--P--L--W--S--S--Q--*-
GAGCACCCCAGACACCTTCCTCAACCCAGGCGGGTGGACAGGGTCCCCCTGTGGTCCAGCCAGTAA
                                                                  
------------------------------------------------------------------
------------------------------------------------------------------