Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000188696 (click for geneview)
Transcript ID ENST00000343005(link to ensembl)
Localtion Chromosome:2:132908401:132909225:1 band: 2q21.2
Description  
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-L--L--M--G--D--G--I--K--N--N--I--L--N--L--Q--G--K--G--L--I--Y--L--S--Q--E--E--L--H--C--W--K--I--W--
CTTCTCATGGGAGATGGGATTAAAAACAACATTTTGAATCTTCAGGGAAAGGGGTTAATTTACCTTTCTCAAGAAGAGCTTCATTGCTGGAAGATTTGGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
K--Q--R--I--R--D--L--S--V--S--Q--D--Y--I--M--N--L--Q--E--Q--C--S--P--H--L--E--D--V--S--L--C--E--E--W
AACAAAGGATCCGGGATTTAAGTGTGAGTCAGGATTATATCATGAACCTTCAAGAACAGTGTTCCCCACATTTAGAAGATGTATCCCTCTGTGAAGAGTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--A--G--M--S--L--Q--I--S--E--N--E--N--Y--V--V--N--A--I--I--K--N--Q--D--I--T--A--W--Q--S--L--T--Q--V-
GGCAGGCATGTCTCTTCAGATTTCTGAAAATGAAAACTATGTAGTAAATGCCATTATCAAAAATCAAGATATCACAGCATGGCAAAGCCTGACACAGGTT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-L--T--P--E--S--W--R--K--A--N--I--M--T--E--P--Q--K--S--Q--G--R--Y--K--G--I--Y--V--E--E--K--L--Y--R--
CTTACTCCAGAATCTTGGAGGAAAGCCAACATAATGACCGAGCCCCAGAAATCTCAGGGAAGATATAAGGGAATTTACGTGGAAGAGAAATTGTACAGAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
H--A--R--H--D--E--S--L--N--W--T--S--R--D--H--H--E--S--Q--E--C--K--G--E--D--P--G--R--H--P--N--C--G--K
ATGCTCGGCATGATGAGAGCCTCAATTGGACCTCACGTGATCATCATGAGTCCCAAGAATGTAAAGGAGAGGACCCTGGTAGACACCCCAACTGTGGGAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--N--L--G--M--K--S--T--V--E--Q--H--H--A--V--H--V--L--P--Q--P--F--T--C--N--N--C--G--V--A--F--A--D--D-
AAACTTGGGTATGAAATCAACAGTTGAACAACATCATGCGGTCCATGTTTTACCACAGCCTTTCACATGTAATAACTGTGGGGTGGCCTTTGCAGATGAT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-T--D--P--R--V--H--H--S--T--H--L--G--E--K--S--Y--K--C--D--Q--Y--G--K--N--L--S--Q--S--Q--Y--L--I--V--
ACAGATCCTCGTGTCCATCACAGCACTCATCTAGGAGAAAAATCTTATAAATGTGACCAGTATGGAAAGAACTTAAGTCAGAGCCAATATCTTATTGTTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
H--C--K--T--H--S--G--E--T--P--Y--E--F--H--E--W--P--T--G--C--K--Q--S--S--D--L--P--R--C--Q--K--V--P--S
ATTGTAAAACCCACTCAGGAGAGACTCCCTATGAATTCCATGAATGGCCTACAGGCTGCAAACAGAGCTCAGACCTTCCCAGATGTCAGAAAGTCCCCTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------>
--G--D--N--P--Y--K--C--K-
AGGAGACAATCCCTACAAATGTAAA
                         
-------------------------
-------------------------