Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000188248 (click for geneview)
Transcript ID ENST00000343051(link to ensembl)
Symbol XP_497834.1
Localtion Chromosome:2:39068519:39095822:1 band: 2p22.1
Description PREDICTED: hypothetical protein XP_497834
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--S--M--I--Q--A--I--T--S--K--Q--E--E--M--Q--Q--K--I--E--Q--L--Q--Q--E--K--R--R--E--S--R--K--V--K--
ATGTCGATGATCCAAGCCATCACTTCCAAACAAGAAGAAATGCAACAGAAAATCGAGCAGCTTCAACAGGAGAAGCGAAGAGAATCTCGAAAAGTTAAAG
:::::.::::::::.::.:::::::::::::::::::::::::::::::::::.::.::::::                                     
ATGTCAATGATCCAGGCTATCACTTCCAAACAAGAAGAAATGCAACAGAAAATTGAACAGCTT-------------------------------------
-M--S--M--I--Q--A--I--T--S--K--Q--E--E--M--Q--Q--K--I--E--Q--L--------------------------------------

---><-----------------------------------------------------------------------------------------------
A--K--K--T--Q--K--E--E--H--S--S--Q--A--G--P--A--Q--A--Q--G--S--P--F--R--S--I--N--I--P--E--P--V--L--P
CCAAGAAAACTCAAAAAGAAGAGCACAGCTCACAGGCCGGGCCTGCCCAAGCACAAGGAAGTCCTTTTCGTTCTATCAATATCCCTGAGCCTGTTCTTCC
     ::::::::.::::::::.::..:::::::: ::::.:::::.::::::::::::::::::::.:::::.:::::.::::::::::::::::::::
-----AAAACTCAGAAAGAAGAACATGGCTCACAGCCCGGACCTGCTCAAGCACAAGGAAGTCCTTTCCGTTCCATCAACATCCCTGAGCCTGTTCTTCC
------K--T--Q--K--E--E--H--G--S--Q--P--G--P--A--Q--A--Q--G--S--P--F--R--S--I--N--I--P--E--P--V--L--P

----------------------------------------------><----------------------------------------------------
--S--E--D--F--T--N--L--L--P--S--Q--A--Y--E--K--A--Q--E--S--R--S--V--H--V--G--D--S--N--V--K--G--M--M-
AAGCGAAGACTTTACCAACCTTTTGCCTTCTCAGGCCTACGAGAAAGCCCAAGAGTCCAGATCTGTTCATGTAGGAGACAGTAATGTAAAAGGAATGATG
:::.::::::::::: ::::::.::::::::::::::::.::.:::                                                      
AAGTGAAGACTTTACAAACCTTCTGCCTTCTCAGGCCTATGAAAAA------------------------------------------------------
--S--E--D--F--T--N--L--L--P--S--Q--A--Y--E--K-------------------------------------------------------

------><--------------------------------------------------------------------------------------------
-G--P--G--V--N--P--T--T--P--E--A--E--E--N--L--K--S--C--L--S--A--D--I--Q--S--K--G--H--L--P--S--G--M--
GGTCCTGGAGTGAACCCAACAACTCCAGAAGCAGAAGAAAACCTCAAGTCTTGCCTCTCGGCTGATATCCAGTCCAAGGGCCATCTCCCATCTGGCATGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
W--R--Q--P--K--D--G--K--E--W--G--E--E--Y--V--T--K--D--H--P--D--K--L--K--E--A--G--Q--G--R--H--S--S--L
GGAGGCAGCCTAAGGATGGTAAAGAATGGGGTGAAGAATACGTCACAAAAGACCACCCAGATAAACTCAAGGAGGCTGGCCAGGGTAGACACAGCTCCTT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------><-------------------------------------------------------------------
--E--N--V--L--C--E--T--S--L--A--A--K--R--Q--T--V--A--L--E--L--L--E--S--E--R--K--Y--V--I--N--I--S--L-
GGAAAACGTTTTATGTGAAACCTCCTTAGCTGCTAAAAGACAGACTGTGGCCCTGGAACTGCTTGAATCTGAAAGAAAATATGTCATTAACATCTCTCTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------------------------><-------------------------------------
-I--L--K--I--K--A--T--F--Q--G--S--D--G--K--R--N--S--K--E--R--S--L--F--P--G--S--L--R--Y--L--V--Q--Q--
ATCTTGAAGATAAAAGCCACATTCCAGGGGTCAGATGGAAAGAGGAATTCCAAAGAGAGAAGCCTCTTCCCTGGCTCTTTACGGTACCTCGTCCAGCAGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------><----
H--L--D--L--L--H--A--L--Q--E--R--V--L--K--W--P--R--Q--G--V--L--G--D--L--F--L--K--L--T--N--D--E--N--N
ACCTGGATCTGCTTCACGCACTGCAGGAAAGGGTCCTGAAGTGGCCACGCCAAGGCGTTCTTGGAGATTTATTCCTTAAGTTAACAAATGACGAGAATAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------------------------------------------><--------------------
--F--L--D--Y--Y--V--A--Y--L--R--D--L--P--E--C--I--S--L--V--H--V--V--V--L--K--E--G--D--E--E--I--K--S-
TTTCTTGGATTATTATGTTGCCTACCTAAGGGACCTGCCTGAGTGCATCTCATTGGTTCATGTTGTAGTCCTGAAAGAGGGTGATGAAGAGATTAAATCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------------------><------------------------------------
-D--I--Y--T--L--F--F--H--I--V--Q--R--I--P--E--Y--L--I--H--L--Q--N--V--L--K--F--T--E--Q--E--H--P--D--
GACATCTACACGTTGTTTTTTCACATAGTCCAGCGCATCCCTGAATATCTGATACATCTGCAGAACGTCCTGAAGTTCACAGAGCAGGAGCACCCTGACT
                                                               ::.::::::::.::::::::::::::.::::::::::
---------------------------------------------------------------AATGTCCTGAAATTCACAGAGCAGGAACACCCTGACT
----------------------------------------------------------------N--V--L--K--F--T--E--Q--E--H--P--D--

---------------------------------------------------------------------------------------------->
Y--Y--L--L--L--V--C--V--Q--R--L--R--V--F--I--S--H--Y--T--L--L--F--Q--C--N--E--D--L--L--I--Q--K-
ATTATCTACTACTGGTGTGTGTCCAGCGCCTCCGAGTATTTATCTCACACTACACCCTGCTGTTTCAATGCAATGAAGATTTGCTTATTCAGAAA
::::..:::: :::::::::::.:::::::: :::::::::::::::::::::::::::::.::::::::::::::.::::::::::::::::::
ATTACTTACTTCTGGTGTGTGTTCAGCGCCTGCGAGTATTTATCTCACACTACACCCTGCTATTTCAATGCAATGAGGATTTGCTTATTCAGAAA
Y--Y--L--L--L--V--C--V--Q--R--L--R--V--F--I--S--H--Y--T--L--L--F--Q--C--N--E--D--L--L--I--Q--K-

Pig Consensus Sequence

>BGISUST0000900182
ATGTCAATGATCCAGGCTATCACTTCCAAACAAGAAGAAATGCAACAGAAAATTGAACAGCTT-------------------------------------
-----AAAACTCAGAAAGAAGAACATGGCTCACAGCCCGGACCTGCTCAAGCACAAGGAAGTCCTTTCCGTTCCATCAACATCCCTGAGCCTGTTCTTCC
AAGTGAAGACTTTACAAACCTTCTGCCTTCTCAGGCCTATGAAAAA------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
---------------------------------------------------------------AATGTCCTGAAATTCACAGAGCAGGAACACCCTGACT
ATTACTTACTTCTGGTGTGTGTTCAGCGCCTGCGAGTATTTATCTCACACTACACCCTGCTATTTCAATGCAATGAGGATTTGCTTATTCAGAAA


>BGISUSP0000900182
MSMIQAITSKQEEMQQKIEQL--------------KTQKEEHGSQPGPAQAQGSPFRSINIPEPVLPSEDFTNLLPSQAYEK------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
---------------------NVLKFTEQEHPDYYLLLVCVQRLRVFISHYTLLFQCNEDLLIQK