Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000198517 (click for geneview)
Transcript ID ENST00000343242(link to ensembl)
Symbol MAFK
Localtion Chromosome:7:1343609:1353610:1 band: 7p22.3
Description Transcription factor MafK (Erythroid transcription factor NF-E2 p18 subunit). [Source:Uniprot/SWISSPROT;Acc:O60675]
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<----------------------------------><---------------------------------------------------------------
-M--T--T--N--P--K--P--N--K--A--L--K--V--K--K--E--A--G--E--N--A--P--V--L--S--D--D--E--L--V--S--M--S--
ATGACGACTAATCCCAAACCGAATAAGGCATTAAAGGTCAAGAAGGAGGCGGGCGAGAACGCCCCGGTGCTCAGCGATGATGAGCTGGTGTCCATGTCGG
                                    :::::::::::::.:::::::::::::::::::::::::::.::::::::::::::::::::::
------------------------------------GTCAAGAAGGAGGTGGGCGAGAACGCCCCGGTGCTCAGCGACGATGAGCTGGTGTCCATGTCGG
-------------------------------------V--K--K--E--V--G--E--N--A--P--V--L--S--D--D--E--L--V--S--M--S--

----------------------------------------------------------------------------------------------------
V--R--E--L--N--Q--H--L--R--G--L--T--K--E--E--V--T--R--L--K--Q--R--R--R--T--L--K--N--R--G--Y--A--A--S
TGCGGGAGCTGAACCAGCACCTGCGGGGTCTCACCAAGGAGGAGGTGACCCGCCTGAAGCAGCGTCGGCGCACACTCAAGAACCGCGGCTACGCGGCCAG
::::::::::::::::::::::::: ::.::  ::::::::::::::..:::::::::::::::.:: :::::.::::::::::::::::::::::::::
TGCGGGAGCTGAACCAGCACCTGCGCGGCCTGTCCAAGGAGGAGGTGGTCCGCCTGAAGCAGCGCCGCCGCACGCTCAAGAACCGCGGCTACGCGGCCAG
V--R--E--L--N--Q--H--L--R--G--L--S--K--E--E--V--V--R--L--K--Q--R--R--R--T--L--K--N--R--G--Y--A--A--S

----------------------------------------------------------------------------------------------------
--C--R--I--K--R--V--T--Q--K--E--E--L--E--R--Q--R--V--E--L--Q--Q--E--V--E--K--L--A--R--E--N--S--S--M-
CTGCCGCATCAAGCGGGTGACGCAGAAGGAGGAGCTGGAGCGGCAGCGCGTGGAGCTGCAGCAGGAGGTGGAGAAGCTGGCGCGTGAGAACAGCAGCATG
::::::::::::::: :::::::::::::::::::::::::::::::: :::::::::::::::::::::::::::::::: ::.:::::::::::::::
CTGCCGCATCAAGCGCGTGACGCAGAAGGAGGAGCTGGAGCGGCAGCGGGTGGAGCTGCAGCAGGAGGTGGAGAAGCTGGCCCGCGAGAACAGCAGCATG
--C--R--I--K--R--V--T--Q--K--E--E--L--E--R--Q--R--V--E--L--Q--Q--E--V--E--K--L--A--R--E--N--S--S--M-

----------------------------------------------------------------------------------------------------
-R--L--E--L--D--A--L--R--S--K--Y--E--A--L--Q--T--F--A--R--T--V--A--R--G--P--V--A--P--S--K--V--A--T--
CGGCTGGAGCTGGACGCCCTGCGCTCCAAGTACGAGGCGCTGCAGACCTTCGCGCGCACCGTGGCCCGGGGACCTGTGGCGCCCTCCAAGGTGGCCACCA
 .:::::::::::::::::::::::::::::::::::: :::::::::::.:: ::::: :::::::: :: ::..: .:.::: :::::::::::::::
AAGCTGGAGCTGGACGCCCTGCGCTCCAAGTACGAGGCCCTGCAGACCTTTGCCCGCACGGTGGCCCGCGGCCCCATCACACCCACCAAGGTGGCCACCA
-K--L--E--L--D--A--L--R--S--K--Y--E--A--L--Q--T--F--A--R--T--V--A--R--G--P--I--T--P--T--K--V--A--T--

---------------------------------------------------------------------->
T--S--V--I--T--I--V--K--S--T--E--L--S--S--T--S--V--P--F--S--A--A--S--*-
CCAGCGTCATCACCATCGTCAAGTCCACCGAGCTCTCCTCCACCTCCGTGCCCTTCTCGGCTGCATCCTAG
::::::::::::::::::::::::: .::::: :::::::::::                           
CCAGCGTCATCACCATCGTCAAGTCAGCCGAGATCTCCTCCACC---------------------------
T--S--V--I--T--I--V--K--S--A--E--I--S--S--T----------------------------

Pig Consensus Sequence

>BGISUST0000885806
------------------------------------GTCAAGAAGGAGGTGGGCGAGAACGCCCCGGTGCTCAGCGACGATGAGCTGGTGTCCATGTCGG
TGCGGGAGCTGAACCAGCACCTGCGCGGCCTGTCCAAGGAGGAGGTGGTCCGCCTGAAGCAGCGCCGCCGCACGCTCAAGAACCGCGGCTACGCGGCCAG
CTGCCGCATCAAGCGCGTGACGCAGAAGGAGGAGCTGGAGCGGCAGCGGGTGGAGCTGCAGCAGGAGGTGGAGAAGCTGGCCCGCGAGAACAGCAGCATG
AAGCTGGAGCTGGACGCCCTGCGCTCCAAGTACGAGGCCCTGCAGACCTTTGCCCGCACGGTGGCCCGCGGCCCCATCACACCCACCAAGGTGGCCACCA
CCAGCGTCATCACCATCGTCAAGTCAGCCGAGATCTCCTCCACC---------------------------


>BGISUSP0000885806
------------VKKEVGENAPVLSDDELVSMSVRELNQHLRGLSKEEVVRLKQRRRTLKNRGYAASCRIKRVTQKEELERQRVELQQEVEKLARENSSM
KLELDALRSKYEALQTFARTVARGPITPTKVATTSVITIVKSAEISST---------