Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000187540 (click for geneview)
Transcript ID ENST00000343845(link to ensembl)
Symbol XP_371009.1
Localtion Chromosome:17:6495783:6497273:1 band: 17p13.1
Description PREDICTED: hypothetical protein XP_371009
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-G--R--M--A--S--A--R--G--A--K--Q--S--S--P--R--V--G--T--T--R--Y--T--E--T--S--T--V--R--V--E--T--S--S--
GGCAGAATGGCCTCAGCCCGAGGGGCCAAGCAGTCTTCGCCCCGGGTGGGGACCACCCGCTACACAGAGACGTCCACGGTCCGCGTGGAGACCTCGTCCC
      ::::::::: :::   :::  ::::  :: . ::::::::.:: :.::.::::::::  .:::::::: ::::: :::::.:::::::::::::
------ATGGCCTCACCCCTTCGGGGAAAGCCCTCGCGGCCCCGGGCGGCGGCCGCCCGCTACTAGGAGACGTCGACGGTACGCGTAGAGACCTCGTCCC
-------M--A--S--P--L--R--G--K--P--S--R--P--R--A--A--A--A--R--Y--*--E--T--S--T--V--R--V--E--T--S--S--

----------------------------------------------------------------------------------------------------
H--R--V--E--T--S--S--R--R--V--E--T--S--Q--R--R--S--E--G--P--S--L--S--P--S--G--K--R--L--P--R--I--L--E
ACCGCGTGGAGACGTCGTCCCGGCGGGTGGAGACCTCCCAGCGCCGCAGCGAGGGGCCCTCCCTCTCCCCCTCGGGGAAGCGGCTCCCTCGCATCCTCGA
:::::::::::::.::                                                                                    
ACCGCGTGGAGACATCC-----------------------------------------------------------------------------------
H--R--V--E--T--S------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--A--S--S--R--H--V--E--S--S--S--Q--R--T--E--T--T--S--R--H--V--R--A--S--S--L--R--V--E--T--S--L--H--C-
GGCGTCCTCCCGGCACGTGGAATCCTCCTCGCAGCGCACGGAAACGACCTCCCGCCACGTCAGAGCCTCGTCCCTGAGGGTGGAGACGTCTCTGCACTGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-A--E--S--P--T--P--R--P--S--R--P--P--A--R--T--K--K--R--P--D--E--M--L--L--P--K--G--H--Q--G--A--R--A--
GCGGAGAGCCCGACCCCGCGGCCAAGCCGGCCGCCCGCCAGAACGAAAAAACGGCCCGATGAGATGCTGCTTCCCAAAGGCCACCAAGGGGCCAGGGCCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
L--S--Q--D--R--K--A--S--S--C--Q--P--A--S--Q--L--P--G--G--P--I--I--F--G--F--M--E--T--N--H--K--S--M--*
TCAGCCAGGACAGAAAGGCCTCCAGTTGCCAGCCAGCCAGCCAGCTGCCAGGTGGACCAATCATTTTCGGTTTCATGGAAACAAACCATAAATCAATGTA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

>
-
A
 
-
-

Pig Consensus Sequence

>BGISUST0000887282
------ATGGCCTCACCCCTTCGGGGAAAGCCCTCGCGGCCCCGGGCGGCGGCCGCCCGCTACTAGGAGACGTCGACGGTACGCGTAGAGACCTCGTCCC
ACCGCGTGGAGACATCC-----------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
-


>BGISUSP0000887282
--MASPLRGKPSRPRAAAARY*ETSTVRVETSSHRVETS-------------------------------------------------------------
-------------------------------------------------------------------