Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000022976 (click for geneview)
Transcript ID ENST00000343913(link to ensembl)
Symbol Q9NT83_HUMAN
Localtion Chromosome:14:101853467:101878269:1 band: 14q32.32
Description Hypothetical protein DKFZp434M1123 (Fragment).
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--L--T--P--L--S--A--S--D--P--L--A--V--T--S--L--S--S--S--S--A--H--P--F--I--S--N--L--H--T--R--H--T--
ATGTTGACCCCTTTGTCTGCCTCTGACCCGCTGGCAGTAACATCTCTTTCATCCAGTTCAGCACATCCATTTATTTCCAACTTGCATACAAGACATACTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
E--K--L--K--K--S--L--K--V--K--T--R--S--G--R--V--S--R--P--P--K--Y--K--A--K--D--Y--K--F--I--K--T--E--D
AGAAACTAAAAAAATCGTTAAAAGTAAAGACACGTTCTGGACGGGTATCTCGACCTCCCAAATATAAAGCTAAAGATTATAAGTTCATAAAAACAGAGGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--L--A--D--G--H--L--S--D--S--D--D--Y--S--E--L--C--V--E--E--D--E--D--Q--R--E--R--H--A--L--F--D--L--S-
TCTGGCGGATGGTCATCTGTCAGATTCTGATGATTACTCAGAACTCTGTGTGGAAGAAGATGAAGATCAGAGGGAGAGGCACGCACTCTTTGACTTATCG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-S--C--S--L--R--P--K--S--F--K--C--Q--T--C--E--K--S--Y--I--G--K--G--G--L--A--R--H--F--K--L--N--P--G--
AGCTGCTCCCTGAGGCCCAAAAGCTTTAAGTGTCAGACTTGTGAAAAGTCATATATAGGGAAGGGGGGACTGGCCCGACATTTTAAACTTAACCCAGGCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
H--G--Q--L--D--P--E--M--V--L--S--E--K--A--S--G--S--T--L--R--G--C--T--E--E--R--T--L--S--L--T--S--L--G
ACGGCCAGTTGGACCCCGAGATGGTGCTGTCTGAGAAAGCCAGTGGAAGCACCCTCCGGGGGTGCACGGAGGAAAGGACGCTCAGCCTGACCTCCCTGGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------------------------------------------><--------------------
--L--S--M--P--A--D--P--C--E--G--G--A--R--S--C--L--V--T--E--S--A--R--G--G--L--Q--N--G--Q--S--V--D--V-
GCTGTCCATGCCAGCGGATCCATGTGAGGGAGGGGCCCGCTCCTGCTTGGTGACAGAGTCAGCACGCGGTGGCCTGCAGAATGGTCAGTCTGTAGACGTT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-E--E--T--L--P--S--E--P--E--N--G--A--L--L--R--S--E--R--Y--Q--G--P--R--R--R--A--C--S--E--T--L--A--E--
GAAGAGACATTGCCATCTGAACCAGAAAATGGAGCTCTTTTGCGATCAGAGAGATACCAAGGACCTAGAAGACGCGCATGCTCAGAGACCCTTGCAGAGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
S--R--T--A--V--L--Q--Q--R--R--A--A--Q--L--P--G--G--P--A--A--A--G--E--Q--R--A--S--P--S--K--A--R--L--K
CCCGCACAGCTGTCCTCCAGCAGAGAAGAGCTGCTCAGCTACCTGGTGGCCCTGCTGCGGCAGGGGAGCAGAGGGCGTCGCCAAGCAAAGCCAGGCTCAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---><-------------------------------------------------------------------------------------------><--
--E--F--L--Q--Q--C--D--R--E--D--L--V--E--L--A--L--P--Q--L--A--Q--V--V--T--V--Y--E--F--L--L--M--K--V-
GGAGTTCCTCCAGCAGTGTGACCGGGAGGATCTGGTGGAATTGGCTCTGCCTCAGCTGGCTCAGGTTGTGACCGTGTATGAGTTTCTTCTGATGAAGGTT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-E--K--D--H--L--A--K--P--F--F--P--A--I--Y--K--E--F--E--E--L--H--K--M--V--K--K--M--C--Q--D--Y--L--S--
GAAAAAGATCATCTAGCAAAGCCTTTTTTCCCAGCTATATATAAGGAATTTGAAGAGTTGCATAAAATGGTTAAGAAAATGTGCCAAGATTACCTCAGTA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------><----------------------------------------------------
S--S--G--L--C--S--Q--E--T--L--E--I--N--N--D--K--V--A--E--S--L--G--I--T--E--F--L--R--K--K--E--I--H--P
GTTCTGGTCTGTGTTCCCAGGAGACCCTGGAAATAAACAATGATAAGGTTGCTGAGTCATTAGGAATCACAGAATTCCTACGGAAGAAAGAAATACACCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------------------------------------------------><--------------
--D--N--L--G--P--K--H--L--S--R--D--M--D--G--E--Q--L--E--G--A--S--S--E--K--R--E--R--E--A--A--E--E--G-
AGACAACCTTGGACCCAAGCACCTCAGCCGAGACATGGATGGGGAGCAGCTAGAGGGAGCTAGCAGCGAGAAGAGGGAACGTGAGGCTGCGGAGGAGGGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-L--A--S--V--K--R--P--R--R--E--A--L--S--N--D--T--T--E--S--L--A--A--N--S--R--G--R--E--K--P--R--P--L--
CTGGCCTCAGTGAAAAGGCCCAGAAGAGAAGCCCTGTCCAACGATACCACTGAATCTCTTGCTGCCAACAGCAGAGGCCGGGAGAAGCCCAGGCCCTTGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------><--------------------------------------------------------------------------->
H--A--L--A--A--G--T--I--V--S--Q--E--E--D--I--V--T--V--T--D--A--E--G--R--A--C--G--W--A--R--*-
ATGCTTTGGCCGCTGGTACAATAGTGTCTCAGGAGGAGGACATTGTCACAGTGACTGATGCAGAGGGGCGTGCCTGCGGATGGGCCCGCTAG
                                                                                            
--------------------------------------------------------------------------------------------
--------------------------------------------------------------------------------------------