Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000189051 (click for geneview)
Transcript ID ENST00000344001(link to ensembl)
Localtion Chromosome:17:8236842:8237504:-1 band: 17p13.1
Description  
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--S--E--G--E--S--K--D--S--S--G--S--E--C--P--V--C--Y--E--K--F--R--D--L--E--G--A--S--R--T--L--S--C--
ATGTCAGAAGGGGAGAGCAAGGACAGCTCGGGCAGTGAGTGCCCCGTGTGCTATGAGAAGTTCCGGGACCTGGAGGGCGCCAGCCGGACGCTGAGCTGTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
G--H--V--F--C--H--D--C--L--V--K--Y--L--L--S--T--R--V--D--G--Q--V--Q--R--T--L--V--C--P--I--C--R--Y--V
GCCATGTGTTCTGCCATGACTGCCTGGTCAAGTACCTGCTGTCCACCCGCGTGGATGGGCAGGTCCAGAGGACCCTGGTCTGCCCCATCTGCCGCTACGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--T--F--L--S--K--K--S--S--R--W--P--S--M--L--D--K--S--S--Q--T--L--A--V--P--V--G--L--P--S--V--P--P--L-
CACATTCCTCAGCAAGAAGAGCTCCCGCTGGCCCTCCATGCTGGACAAGAGCTCCCAGACGCTGGCTGTGCCCGTGGGCCTGCCCTCCGTGCCCCCACTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------><----------------------------------------
-D--S--L--G--H--T--N--P--L--A--A--S--S--P--A--W--R--P--P--P--A--Q--L--P--L--D--L--L--P--S--L--P--R--
GACAGCCTGGGCCACACAAACCCCCTGGCCGCCTCCTCCCCTGCCTGGAGGCCACCTCCCGCCCAGCTCCCCCTGGACCTGCTGCCCAGCCTGCCCCGGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
E--S--Q--I--F--V--I--S--R--H--G--M--P--L--G--E--Q--D--S--V--L--P--R--R--S--L--A--E--L--S--E--A--S--L
AGTCACAGATCTTTGTCATCAGCCGCCACGGGATGCCCCTGGGGGAGCAGGACAGCGTGCTGCCCCGCCGCAGCCTGGCAGAGCTCTCGGAGGCCTCCCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--A--P--R--S--A--R--A--F--C--C--R--S--R--A--L--L--L--I--T--L--I--A--V--V--A--V--V--A--A--I--L--P--W-
GGCGCCCCGCTCCGCCCGCGCCTTCTGCTGCCGATCGCGGGCCCTGCTGCTCATCACGCTCATCGCTGTGGTGGCCGTGGTGGCCGCCATCCTGCCCTGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------->
-V--L--L--V--R--K--Q--A--*-
GTGCTGCTGGTGAGGAAGCAGGCGTGA
                           
---------------------------
---------------------------