Sequences
EST Library Info
ret3Retina
Clusters
Oligos
SNPs

Gene ID ENSG00000189237 (click for geneview)
Transcript ID ENST00000344027(link to ensembl)
Symbol Q6ZVE2_HUMAN
Localtion Chromosome:2:133263106:133373360:-1 band: 2q21.2
Description Hypothetical protein FLJ42668.
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<------------------><-------------------------------------------------------------------------------
-M--T--E--L--L--N--R--V--D--K--K--A--A--P--Q--T--E--S--G--S--S--N--A--S--C--R--N--V--L--K--G--S--S--
ATGACGGAACTCTTGAACAGAGTTGATAAGAAAGCAGCTCCACAGACAGAAAGTGGATCAAGTAATGCTTCCTGCAGGAATGTGTTAAAGGGCAGTTCTC
                     ::::::::::::::::::: ::::::::::::::::::::.:::::.:::::::::.:...:::::::::::::.::.:
---------------------GTTGATAAGAAAGCAGCTCAACAGACAGAAAGTGGATCAAATAATGTTTCCTGCAGAAGCATGTTAAAGGGCAGCTCCC
----------------------V--D--K--K--A--A--Q--Q--T--E--S--G--S--N--N--V--S--C--R--S--M--L--K--G--S--S--

-------------------------------------------------------------------------------------------------><-
Q--G--S--C--L--I--G--S--S--I--S--T--Q--G--N--H--K--K--N--M--K--I--K--A--D--M--E--V--P--K--D--S--L--V
AGGGCTCCTGTCTCATCGGCAGCTCTATCAGTACTCAAGGAAACCACAAGAAAAACATGAAAATCAAAGCCGATATGGAAGTACCAAAAGACTCCCTGGT
:::::.:::::::: .:.:::::::::::::.:::::.::::::::::.:::.::::: ::::.::::::.:::::::: .::::.::.:..::::::  
AGGGCCCCTGTCTCCCCAGCAGCTCTATCAGCACTCAGGGAAACCACAGGAAGAACATCAAAACCAAAGCTGATATGGACATACCGAAGGGTTCCCTG--
Q--G--P--C--L--P--S--S--S--I--S--T--Q--G--N--H--R--K--N--I--K--T--K--A--D--M--D--I--P--K--G--S--L---

----------------------------------------------------------------------------><----------------------
--K--E--A--N--E--N--L--Q--E--D--E--D--D--A--V--A--D--S--V--F--Q--S--H--I--I--E--S--N--C--Q--M--R--T-
AAAAGAGGCAAATGAAAACTTGCAAGAGGATGAAGACGATGCAGTTGCAGATTCTGTATTTCAGAGCCACATCATAGAATCCAACTGCCAGATGAGAACA
 :::::::::::::::.::.::: ::::::::::   ::..::::::: :::::::.::::::::::::...::::    : ::::::::::::::.:::
-AAAGAGGCAAATGAAGACCTGCCAGAGGATGAA---GACACAGTTGCTGATTCTGCATTTCAGAGCCATGCCATA---ACAAACTGCCAGATGAGGACA
--K--E--A--N--E--D--L--P--E--D--E-----D--T--V--A--D--S--A--F--Q--S--H--A--I-----T--N--C--Q--M--R--T-

----------------------------------------------------------------------------------------------------
-L--D--S--G--I--G--T--F--P--L--P--D--S--G--N--R--S--T--G--R--Y--L--C--Q--P--D--S--P--E--D--A--E--P--
TTGGACAGTGGGATCGGAACCTTTCCACTCCCAGACTCGGGAAATCGCTCGACAGGACGCTACCTATGCCAGCCAGACTCCCCAGAGGACGCTGAGCCTC
.::::::::::.::.::::::::.::::::::::::::.:::::::::::.::.::::: ::: :.::::::::::::::::: :::::.::::::.:.:
CTGGACAGTGGAATTGGAACCTTCCCACTCCCAGACTCAGGAAATCGCTCAACGGGACGATACATGTGCCAGCCAGACTCCCCCGAGGATGCTGAGTCCC
-L--D--S--G--I--G--T--F--P--L--P--D--S--G--N--R--S--T--G--R--Y--M--C--Q--P--D--S--P--E--D--A--E--S--

----------------------------------------------------------------------------------------------------
L--L--P--L--Q--S--A--L--S--A--V--S--S--M--R--A--Q--T--L--E--R--E--V--P--S--S--T--D--G--Q--R--P--A--D
TCCTGCCTCTCCAGTCAGCCCTTTCTGCAGTTTCTTCCATGAGAGCCCAAACCCTTGAACGTGAAGTGCCTTCCTCCACAGACGGCCAGCGCCCTGCAGA
::::::::::::::.:::::::::.:::::.:::::::.:.:.::::::.::::::::::: ::::::::::::::..:::::.::::: ::.:::::::
TCCTGCCTCTCCAGCCAGCCCTTTTTGCAGCTTCTTCCGTAAAAGCCCAGACCCTTGAACGAGAAGTGCCTTCCTCTGCAGACAGCCAGAGCTCTGCAGA
L--L--P--L--Q--P--A--L--F--A--A--S--S--V--K--A--Q--T--L--E--R--E--V--P--S--S--A--D--S--Q--S--S--A--E

----------------------------------------------------------------------------------------------><----
--S--A--I--V--H--S--T--S--D--P--I--M--T--A-----R--G--M--R--P--L--Q--S--R--L--P--K--P--A--S--S--G--K-
TAGCGCCATTGTTCATTCCACATCCGACCCCATCATGACCGCC---AGAGGGATGAGGCCTCTTCAGAGCCGCCTCCCCAAACCAGCTTCCTCAGGAAAA
 :.:.:::::::.:::::.::::::::::::::..::::.:::    .:::.      ::::::::.::.                              
AAACACCATTGTCCATTCTACATCCGACCCCATTGTGACTGCCA--CAAGGATGCTCCCCTCTTCAAAGT------------------------------
--N--T--I--V--H--S--T--S--D--P--I--V--T--A--\--K--G--C--S--P--L--Q--S-------------------------------

----------------------------------------------------------------------------------------------------
-V--S--S--Q--K--Q--N--E--A--E--P--R--P--Q--T--C--S--S--F--G--Y--A--E--D--P--M--A--S--Q--P--L--P--D--
GTCAGTTCCCAAAAGCAGAATGAAGCAGAGCCAAGGCCTCAGACATGCTCATCATTCGGATATGCTGAAGACCCAATGGCAAGCCAGCCGCTTCCAGACT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------><-------------------------------------------------------------------
W--G--S--E--V--A--A--T--G--T--Q--D--K--A--P--R--M--C--T--Y--S--A--S--G--G--S--N--S--D--S--D--L--D--Y
GGGGGAGTGAAGTTGCTGCCACCGGGACCCAGGACAAGGCACCCAGAATGTGTACGTACTCTGCCAGCGGTGGCAGTAATAGTGACAGTGACCTGGACTA
                                :::::: .:::::::::::::.:.:::::::::::::::::::::.:::::::::::::::.::::::
--------------------------------GACAAGTTACCCAGAATGTGTGCATACTCTGCCAGCGGTGGCAGTGATAGTGACAGTGACCCGGACTA
---------------------------------D--K--L--P--R--M--C--A--Y--S--A--S--G--G--S--D--S--D--S--D--P--D--Y

----------------------------------------------------------------><--------------->
--G--D--N--G--F--G--A--G--R--G--Q--L--V--K--A--L--K--S--A--A--P--E--I--E--T--T--*-
TGGAGATAATGGTTTTGGAGCTGGAAGGGGACAGTTAGTGAAAGCACTGAAGAGCGCTGCCCCAGAAATTGAGACAACTTGA
::::.::::::::::::::                                                               
TGGAAATAATGGTTTTGGA---------------------------------------------------------------
--G--N--N--G--F--G----------------------------------------------------------------

Pig Consensus Sequence

>BGISUST0000878911
---------------------GTTGATAAGAAAGCAGCTCAACAGACAGAAAGTGGATCAAATAATGTTTCCTGCAGAAGCATGTTAAAGGGCAGCTCCC
AGGGCCCCTGTCTCCCCAGCAGCTCTATCAGCACTCAGGGAAACCACAGGAAGAACATCAAAACCAAAGCTGATATGGACATACCGAAGGGTTCCCTG--
-AAAGAGGCAAATGAAGACCTGCCAGAGGATGAAGACACAGTTGCTGATTCTGCATTTCAGAGCCATGCCATA---ACAAACTGCCAGATGAGGACACTG
GACAGTGGAATTGGAACCTTCCCACTCCCAGACTCAGGAAATCGCTCAACGGGACGATACATGTGCCAGCCAGACTCCCCCGAGGATGCTGAGTCCCTCC
TGCCTCTCCAGCCAGCCCTTTTTGCAGCTTCTTCCGTAAAAGCCCAGACCCTTGAACGAGAAGTGCCTTCCTCTGCAGACAGCCAGAGCTCTGCAGAAAA
CACCATTGTCCATTCTACATCCGACCCCATTGTGACTGCccAAGGATGCTCCCCTCTTCAAAGT------------------------------------
----------------------------------------------------------------------------------------------------
--------------------------GACAAGTTACCCAGAATGTGTGCATACTCTGCCAGCGGTGGCAGTGATAGTGACAGTGACCCGGACTATGGAAA
TAATGGTTTTGGA---------------------------------------------------------------


>BGISUSP0000878911
-------VDKKAAQQTESGSNNVSCRSMLKGSSQGPCLPSSSISTQGNHRKNIKTKADMDIPKGSL-KEANEDLPEDEDTVADSAFQSHAI-TNCQMRTL
DSGIGTFPLPDSGNRSTGRYMCQPDSPEDAESLLPLQPALFAASSVKAQTLEREVPSSADSQSSAENTIVHSTSDPIVTAQGCSPLQS------------
------------------------------------------DKLPRMCAYSASGGSDSDSDPDYGNNGFG---------------------