Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000187602 (click for geneview)
Transcript ID ENST00000344406(link to ensembl)
Localtion Chromosome:17:7174495:7178844:1 band: 17p13.1
Description  
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--E--K--V--E--S--L--G--A--A--G--G--L--N--R--D--S--P--G--G--A--A--R--G--V--P--A--A--V--T--G--V--E--
ATGGAGAAGGTGGAGTCCCTAGGGGCTGCTGGCGGCCTCAACCGGGATTCCCCTGGAGGGGCAGCCAGAGGAGTGCCCGCAGCGGTCACAGGAGTCGAGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
A--G--A--G--Q--P--S--R--V--V--L--F--H--G--S--G--P--H--V--H--S--G--G--S--V--T--H--S--T--G--S--S--C--P
CAGGCGCTGGGCAGCCCTCCAGAGTAGTCTTGTTTCACGGTTCTGGGCCCCACGTGCACTCAGGGGGCTCCGTAACTCATAGTACTGGTTCAAGCTGTCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--S--G--G--I--V--V--L--G--S--G--P--S--Q--H--P--R--E--A--A--N--H--S--L--G--S--G--R--N--P--G--G--F--N-
CTCCGGGGGGATAGTGGTCCTTGGTTCCGGGCCCAGTCAGCACCCAAGGGAGGCTGCGAACCACAGCCTTGGGTCTGGCAGGAACCCTGGTGGATTCAAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-I--P--G--P--R--T--S--V--S--R--A--S--S--P--G--P--G--G--P--A--G--Q--E--V--N--S--P--G--C--S--P--H--S--
ATCCCCGGGCCTCGAACCAGTGTATCCAGGGCTTCCAGCCCCGGGCCTGGGGGACCTGCAGGGCAAGAGGTAAACAGCCCCGGGTGCAGTCCGCACTCTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
G--P--T--C--L--N--P--Q--N--S--Q--Q--D--R--P--R--S--I--L--R--K--N--S--S--N--L--M--Q--K--S--P--N--V--E
GGCCAACTTGCTTGAACCCCCAAAACTCCCAACAGGACCGGCCCCGGAGCATCCTACGAAAGAACAGCTCCAACTTGATGCAGAAATCCCCCAATGTGGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--><------------------------------------------------------------------------------------------------
--K--R--K--S--Q--H--W--D--E--M--N--I--L--A--T--Y--R--P--A--D--K--D--Y--G--F--M--M--V--D--E--P--N--T-
GAAAAGGAAGTCTCAGCACTGGGACGAGATGAATATCCTGGCCACCTACCGCCCTGCTGACAAGGACTATGGATTTATGATGGTGGATGAGCCCAACACT
    ::.:::::::::::::::::.::.::::::::::::::::::::::.::::::::::::::::::::::::::::: ::::::::::::::.:::.
----AGAAAGTCTCAGCACTGGGATGAAATGAATATCCTGGCCACCTACCACCCTGCTGACAAGGACTATGGATTTATGAAGGTGGATGAGCCCAGCACC
-----R--K--S--Q--H--W--D--E--M--N--I--L--A--T--Y--H--P--A--D--K--D--Y--G--F--M--K--V--D--E--P--S--T-

----------><----------------------------------------------------------------------><----------------
-P--Y--H--R--L--Q--D--S--F--E--D--L--S--A--G--S--S--C--S--V--N--P--G--V--L--A--E--R--I--A--M--M--D--
CCCTACCACAGGCTGCAGGACAGTTTTGAGGACCTCTCTGCCGGCTCCTCCTGCTCAGTGAATCCTGGAGTGCTGGCAGAGAGGATTGCCATGATGGACA
:::::::::                                                                                           
CCCTACCAC-------------------------------------------------------------------------------------------
-P--Y--H--------------------------------------------------------------------------------------------

-----------------------------------------------------------------------><---------------------------
S--I--C--P--R--F--R--Q--D--C--A--D--R--S--S--G--P--A--D--N--F--S--K--I--H--S--T--D--F--D--K--R--R--K
GTATCTGCCCCAGGTTCCGCCAGGACTGTGCTGACAGGAGCTCAGGGCCTGCAGACAACTTTTCCAAGATACACTCCACCGACTTTGACAAGCGCCGCAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--A--H--Y--D--K--G--K--F--L--K--A--Q--K--N--Q--P--L--E--N--E--E--D--E--D--D--N--G--G--I--I--S--I--S-
GGCACACTATGACAAAGGGAAGTTTCTCAAGGCTCAGAAAAACCAGCCCTTGGAGAATGAAGAGGATGAGGATGACAATGGTGGTATTATCAGTATCAGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-G--G--S--Q--G--V--M--L--D--P--E--P--R--P--V--Q--R--G--L--A--G--E--L--A--R--G--A--K--D--E--P--G--L--
GGTGGCAGTCAAGGCGTGATGCTGGACCCAGAGCCCAGGCCTGTGCAGAGAGGCTTGGCAGGAGAACTAGCCAGAGGAGCCAAAGATGAGCCAGGCCTGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------><---------------------><----------------------------------------------
V--T--W--R--H--I--L--E--A--E--D--S--S--T--Y--R--N--Q--P--A--V--A--T--I--I--L--G--Q--E--I--A--L--Q--H
TCACCTGGAGGCACATCCTTGAAGCCGAGGATTCCTCCACCTACAGAAATCAGCCAGCTGTGGCCACTATCATATTGGGGCAGGAGATTGCTCTGCAGCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------------------------------------------------>
--K--E--Y--D--G--K--G--L--Y--L--R--S--C--S--H--P--E--L--V--E--D--V--E--D--E--H--Q--D-
CAAGGAATATGATGGCAAAGGACTATACCTGAGGTCCTGCTCCCACCCAGAGCTTGTAGAGGACGTGGAAGATGAGCATCAGGAT
                                                                                     
-------------------------------------------------------------------------------------
-------------------------------------------------------------------------------------

Pig Consensus Sequence

>BGISUST0000896523
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----AGAAAGTCTCAGCACTGGGATGAAATGAATATCCTGGCCACCTACCACCCTGCTGACAAGGACTATGGATTTATGAAGGTGGATGAGCCCAGCACC
CCCTACCAC-------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
-------------------------------------------------------------------------------------


>BGISUSP0000896523
----------------------------------------------------------------------------------------------------
--------------------------------------------------------------------RKSQHWDEMNILATYHPADKDYGFMKVDEPST
PYH-------------------------------------------------------------------------------------------------
-----------------------------------------------------------------------------------------------