Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000189217 (click for geneview)
Transcript ID ENST00000344485(link to ensembl)
Symbol DNAH2
Localtion Chromosome:17:7604787:7631778:1 band: 17p13.1
Description Axonemal dynein heavy chain isotype2 (Fragment). [Source:Uniprot/SPTREMBL;Acc:O15434]
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--T--L--T--T--A--L--H--L--H--R--G--G--S--P--K--G--P--A--G--T--G--K--T--E--T--V--K--D--L--G--K--A--
ATGACACTGACCACGGCATTGCACCTGCACCGAGGGGGCTCCCCCAAAGGCCCTGCAGGCACAGGCAAGACCGAGACCGTCAAGGACCTGGGCAAGGCCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------><----------------
L--G--I--Y--V--I--V--V--N--C--S--E--G--L--D--Y--K--S--M--G--R--M--Y--S--G--L--A--Q--T--G--A--W--G--C
TGGGCATATATGTCATTGTGGTCAACTGCTCTGAGGGCCTGGACTACAAGTCCATGGGCCGAATGTACTCAGGTCTGGCCCAGACTGGAGCTTGGGGCTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--F--D--E--F--N--R--I--N--I--E--V--L--S--V--V--A--H--Q--I--L--C--I--L--S--A--L--A--A--G--L--T--H--F-
CTTTGATGAGTTTAACCGCATCAACATCGAGGTGCTGTCAGTGGTGGCCCACCAGATCCTGTGCATCCTGTCTGCCCTGGCTGCCGGCCTCACCCATTTC
                                                                                     ::::::::::..:::
-------------------------------------------------------------------------------------GGCCTCACCCGCTTC
--------------------------------------------------------------------------------------G--L--T--R--F-

----------------------------------------------->
-H--F--D--G--F--E--I--N--L--V--W--S--C--G--I--F-
CATTTTGATGGCTTTGAAATAAATCTGGTGTGGTCCTGTGGGATCTTC
.::::::: ::::::::::::::::::.::::::::::::::::::::
TATTTTGAGGGCTTTGAAATAAATCTGATGTGGTCCTGTGGGATCTTC
-Y--F--E--G--F--E--I--N--L--M--W--S--C--G--I--F-

Pig Consensus Sequence

>BGISUST0000901753
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
-------------------------------------------------------------------------------------GGCCTCACCCGCTTC
TATTTTGAGGGCTTTGAAATAAATCTGATGTGGTCCTGTGGGATCTTC


>BGISUSP0000901753
-----------------------------------------------------------------------------------------------GLTRF
YFEGFEINLMWSCGIF