Sequences
EST Library Info
hyp1Hypothalamus
nca1Newborn 115 days, cartillage
ste1M. Semitendinosus
Clusters
Oligos
SNPs

Gene ID ENSG00000168803 (click for geneview)
Transcript ID ENST00000344541(link to ensembl)
Symbol NP_001012987.1
Localtion Chromosome:15:41414598:41433386:1 band: 15q15.3
Description PREDICTED: similar to CG11994-PA
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<-------------------------------------------------------------><------------------------------------
-M--I--E--A--E--E--Q--Q--P--C--K--T--D--F--Y--S--E--L--P--K--V--E--L--H--A--H--L--N--G--S--I--S--S--
ATGATAGAGGCAGAAGAGCAACAGCCTTGCAAGACAGACTTCTATTCTGAATTGCCAAAAGTGGAACTTCATGCCCACTTGAATGGATCCATTAGTTCTC
                                                               :::::::::::.:::::::::::::::::::::::: 
---------------------------------------------------------------GAACTTCATGCTCACTTGAATGGATCCATTAGTTCTA
----------------------------------------------------------------E--L--H--A--H--L--N--G--S--I--S--S--

---------------------------------------------------------------------------------------------><-----
H--T--M--K--K--L--I--A--Q--K--P--D--L--K--I--H--D--Q--M--T--V--I--D--K--G--K--K--R--T--L--E--E--C--F
ATACCATGAAGAAATTAATAGCCCAGAAGCCAGATCTTAAAATCCACGATCAGATGACTGTGATTGACAAGGGAAAGAAAAGAACTTTGGAAGAATGTTT
:::::::.::::::::::::.:: :::::::::.::::::::::::.::::::::::::.::::::::::::::::::::::::::::. ::   :::::
ATACCATAAAGAAATTAATAACCAAGAAGCCAGGTCTTAAAATCCATGATCAGATGACTATGATTGACAAGGGAAAGAAAAGAACTTTACAA---TGTTT
N--T--I--K--K--L--I--T--K--K--P--G--L--K--I--H--D--Q--M--T--M--I--D--K--G--K--K--R--T--L--Q-----C--F

------------------------------------------------------><--------------------------------------------
--Q--M--F--Q--T--I--H--Q--L--T--S--S--P--E--D--I--L--M--V--T--K--D--V--I--K--E--F--A--D--D--G--V--K-
CCAGATGTTTCAAACTATTCATCAGCTTACTAGTAGCCCTGAAGATATTCTAATGGTCACAAAAGATGTCATAAAAGAATTTGCAGATGACGGCGTCAAG
::::::::::: ::.:::::::::.::::::: .:::::::::::::::::::::::::::::::::::::: :::::::::::::::::.::.::::::
CCAGATGTTTCCAATTATTCATCAACTTACTACCAGCCCTGAAGATATTCTAATGGTCACAAAAGATGTCATTAAAGAATTTGCAGATGATGGTGTCAAG
--Q--M--F--P--I--I--H--Q--L--T--T--S--P--E--D--I--L--M--V--T--K--D--V--I--K--E--F--A--D--D--G--V--K-

------------------------------------------><--------------------------------------------------------
-Y--L--E--L--R--S--T--P--R--R--E--N--A--T--G--M--T--K--K--T--Y--V--E--S--I--L--E--G--I--K--Q--S--K--
TACCTGGAACTAAGGAGCACACCCAGAAGAGAAAATGCTACTGGAATGACTAAAAAGACTTATGTGGAATCTATACTTGAAGGTATAAAACAGTCCAAAC
:::::::::::::::::::::                        :::::::::::::::::::::::::::.:::::::.:::::::::::::::::::
TACCTGGAACTAAGGAGCACA------------------------ATGACTAAAAAGACTTATGTGGAATCTGTACTTGAGGGTATAAAACAGTCCAAAC
-Y--L--E--L--R--S--T--------------------------M--T--K--K--T--Y--V--E--S--V--L--E--G--I--K--Q--S--K--

------------------------><--------------------------------------------------------------------------
Q--E--N--L--D--I--D--V--R--Y--L--I--A--V--D--R--R--G--G--P--L--V--A--K--E--T--V--K--L--A--E--E--F--F
AAGAAAACTTGGACATTGATGTTAGGTATTTGATAGCAGTTGACAGAAGAGGTGGCCCTTTAGTAGCCAAGGAGACTGTAAAACTTGCCGAGGAGTTCTT
:.:::::. :.::::::::::::   ::::::::: ::.:.:::::::::::::::::::.::.::::::::::: ::: :::::::: ::.::::::::
AGGAAAATGTAGACATTGATGTT---TATTTGATATCAATCGACAGAAGAGGTGGCCCTTCAGCAGCCAAGGAGAATGTTAAACTTGCAGAAGAGTTCTT
Q--E--N--V--D--I--D--V-----Y--L--I--S--I--D--R--R--G--G--P--S--A--A--K--E--N--V--K--L--A--E--E--F--F

---------------------------------------------------><-----------------------------------------------
--L--S--T--E--G--T--V--L--G--L--D--L--S--G--D--P--T--V--G--Q--A--K--D--F--L--E--P--L--L--E--A--K--K-
CCTTTCTACTGAGGGTACAGTTCTTGGCCTTGACCTCAGTGGAGACCCTACTGTAGGACAAGCAAAAGACTTCTTGGAACCTCTTTTAGAAGCTAAGAAA
::::::::: ::::: :.::::::::::::::::::::::::::::::::::   :::::::::::::::::::::::::::::::::::::::::.:::
CCTTTCTACAGAGGGAATAGTTCTTGGCCTTGACCTCAGTGGAGACCCTACT---GGACAAGCAAAAGACTTCTTGGAACCTCTTTTAGAAGCTAAAAAA
--L--S--T--E--G--I--V--L--G--L--D--L--S--G--D--P--T-----G--Q--A--K--D--F--L--E--P--L--L--E--A--K--K-

--------------------------------><------------------------------------------------------------------
-A--G--L--K--L--A--L--H--L--S--E--I--P--N--Q--K--K--E--T--Q--I--L--L--D--L--L--P--D--R--I--G--H--G--
GCAGGTCTGAAGTTAGCATTGCATCTTTCAGAGATTCCAAACCAAAAAAAAGAAACACAAATACTCCTGGATCTGCTTCCTGACAGAATCGGGCATGGAA
 :::::::::::::.::::::::::::::.:::::::::::::::.::::::::::.:::.::::::::::.:::::::: ::: :::::::::::::.:
TCAGGTCTGAAGTTGGCATTGCATCTTTCGGAGATTCCAAACCAAGAAAAAGAAACGCAAGTACTCCTGGACCTGCTTCCAGACCGAATCGGGCATGGGA
-S--G--L--K--L--A--L--H--L--S--E--I--P--N--Q--E--K--E--T--Q--V--L--L--D--L--L--P--D--R--I--G--H--G--

--------------------------------------------------------------------------><------------------------
T--F--L--N--S--G--E--G--G--S--L--D--L--V--D--F--V--R--Q--H--R--I--P--L--E--L--C--L--T--S--N--V--K--S
CATTTCTCAACTCCGGTGAGGGAGGATCCCTGGATCTGGTGGACTTTGTGAGGCAACATCGGATACCACTGGAACTCTGTTTGACCTCAAACGTCAAAAG
:::::::.:.:: :  ::: ::.:::::::..::.::.:: :::::::::::::::::.:.:::::::      ::::::::::::::::::.:::::::
CATTTCTTAGCTGCTCTGATGGGGGATCCCCAGACCTAGT-GACTTTGTGAGGCAACACCAGATACCA------CTCTGTTTGACCTCAAACATCAAAAG
T--F--L--S--C--S--D--G--G--S--P--D--L--V--D--F--V--R--Q--H--Q--I--P--------L--C--L--T--S--N--I--K--S

---------------------------------------------------------------------------><-----------------------
--Q--T--V--P--S--Y--D--Q--H--H--F--G--F--W--Y--S--I--A--H--P--S--V--I--C--T--D--D--K--G--V--F--A--T-
TCAGACAGTTCCATCTTATGACCAGCACCATTTCGGATTCTGGTACAGCATTGCCCATCCTTCTGTGATCTGTACTGATGATAAGGGTGTTTTTGCAACA
:::::: ::::::::::::::::::::.::.::.::::::::::::::: :::..:::::: :.:::::::::                           
TCAGACTGTTCCATCTTATGACCAGCATCACTTTGGATTCTGGTACAGCCTTGTTCATCCTGCCGTGATCTGT---------------------------
--Q--T--V--P--S--Y--D--Q--H--H--F--G--F--W--Y--S--L--V--H--P--A--V--I--C----------------------------

----------------------------------------------------------------------------------------------------
-H--L--S--Q--E--Y--Q--L--A--A--E--T--F--N--L--T--Q--S--Q--V--W--D--L--S--Y--E--S--I--N--Y--I--F--A--
CACCTTTCTCAAGAGTACCAGCTGGCAGCTGAAACATTTAATTTGACCCAGTCTCAGGTGTGGGATCTGTCTTATGAATCCATCAACTACATCTTTGCTT
                                                      :::::::::::::::::::::::::::::::.::::::::::::::
------------------------------------------------------CAGGTGTGGGATCTGTCTTATGAATCCATCAGCTACATCTTTGCTT
-------------------------------------------------------Q--V--W--D--L--S--Y--E--S--I--S--Y--I--F--A--

-----------------------------------------------------------------------
S--D--S--T--R--S--E--L--R--K--K--W--N--H-----L--K--P--R--V--L--H--I--*-
CTGACAGCACCAGATCTGAACTGAGGAAGAAATGGAATCAC---CTGAAGCCCAGAGTGTTACATATTTAA
::::::::::::..:::: ::::::::::::.::::::::    .:::::::::.::.::::::: :::::
CTGACAGCACCAAGTCTGCACTGAGGAAGAAGTGGAATCAGA--TTGAAGCCCAAAGCGTTACATTTTTAA
S--D--S--T--K--S--A--L--R--K--K--W--N--Q--\--L--K--P--K--A--L--H--F--*-

Pig Consensus Sequence

>BGISUST0000901647
---------------------------------------------------------------GAACTTCATGCTCACTTGAATGGATCCATTAGTTCTA
ATACCATAAAGAAATTAATAACCAAGAAGCCAGGTCTTAAAATCCATGATCAGATGACTATGATTGACAAGGGAAAGAAAAGAACTTTACAA---TGTTT
CCAGATGTTTCCAATTATTCATCAACTTACTACCAGCCCTGAAGATATTCTAATGGTCACAAAAGATGTCATTAAAGAATTTGCAGATGATGGTGTCAAG
TACCTGGAACTAAGGAGCACA------------------------ATGACTAAAAAGACTTATGTGGAATCTGTACTTGAGGGTATAAAACAGTCCAAAC
AGGAAAATGTAGACATTGATGTT---TATTTGATATCAATCGACAGAAGAGGTGGCCCTTCAGCAGCCAAGGAGAATGTTAAACTTGCAGAAGAGTTCTT
CCTTTCTACAGAGGGAATAGTTCTTGGCCTTGACCTCAGTGGAGACCCTACT---GGACAAGCAAAAGACTTCTTGGAACCTCTTTTAGAAGCTAAAAAA
TCAGGTCTGAAGTTGGCATTGCATCTTTCGGAGATTCCAAACCAAGAAAAAGAAACGCAAGTACTCCTGGACCTGCTTCCAGACCGAATCGGGCATGGGA
CATTTCTTAGCTGCTCTGATGGGGGATCCCCAGACCTagACTTTGTGAGGCAACACCAGATACCA------CTCTGTTTGACCTCAAACATCAAAAGTCA
GACTGTTCCATCTTATGACCAGCATCACTTTGGATTCTGGTACAGCCTTGTTCATCCTGCCGTGATCTGT------------------------------
---------------------------------------------------CAGGTGTGGGATCTGTCTTATGAATCCATCAGCTACATCTTTGCTTCTG
ACAGCACCAAGTCTGCACTGAGGAAGAAGTGGAATCAgtTGAAGCCCAAAGCGTTACATTTTTAA


>BGISUSP0000901647
---------------------ELHAHLNGSISSNTIKKLITKKPGLKIHDQMTMIDKGKKRTLQ-CFQMFPIIHQLTTSPEDILMVTKDVIKEFADDGVK
YLELRST--------MTKKTYVESVLEGIKQSKQENVDIDV-YLISIDRRGGPSAAKENVKLAEEFFLSTEGIVLGLDLSGDPT-GQAKDFLEPLLEAKK
SGLKLALHLSEIPNQEKETQVLLDLLPDRIGHGTFLSCSDGGSPDLDFVRQHQIP--LCLTSNIKSQTVPSYDQHHFGFWYSLVHPAVIC----------
-----------------QVWDLSYESISYIFASDSTKSALRKKWNQLKPKALHF*