Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000188132 (click for geneview)
Transcript ID ENST00000344665(link to ensembl)
Symbol Q6ZVQ3_HUMAN
Localtion Chromosome:14:36186046:36188628:1 band: 14q13.3
Description Hypothetical protein FLJ42220.
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--E--A--P--H--P--F--H--S--G--V--A--A--T--H--H--K--S--T--F--R--S--E--L--F--R--G--G--S--R--Q--F--V--
ATGGAGGCCCCCCACCCATTCCACTCCGGGGTTGCGGCCACGCACCATAAGAGCACCTTCAGGTCTGAGCTCTTTAGGGGTGGGAGTAGGCAGTTCGTGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
S--P--G--R--P--A--G--F--P--A--C--C--G--L--S--V--G--P--T--G--A--G--E--G--W--R--G--L--A--G--T--R--G--A
GTCCGGGAAGGCCTGCGGGGTTTCCCGCCTGCTGCGGACTTAGCGTGGGGCCGACCGGGGCTGGCGAGGGCTGGCGAGGACTGGCGGGGACCCGCGGGGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--E--P--A--L--A--K--P--S--S--E--E--R--R--L--W--L--R--A--L--R--S--Q--V--A--G--S--S--R--G--S--G--P--V-
TGAGCCAGCTCTCGCGAAGCCCTCAAGTGAGGAACGGCGCTTGTGGCTGCGCGCTCTCCGCAGCCAAGTTGCAGGGTCCAGCAGGGGCTCAGGTCCTGTT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-P--S--A--D--P--G--S--R--A--L--V--V--S--A--G--G--K--V--T--R--S--G--R--R--R--R--V--R--G--A--E--R--G--
CCCTCCGCAGATCCCGGATCTAGGGCTCTAGTGGTCTCGGCCGGAGGGAAGGTGACGCGCAGTGGGCGCAGACGCAGAGTGCGGGGCGCCGAACGTGGGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
K--E--R--V--Q--R--A--G--E--S--F--R--K--S--G--R--G--R--Y--L--P--V--P--S--P--R--A--T--R--Q--I--G--E--G
AGGAGCGGGTTCAGCGCGCTGGTGAGAGTTTCAGGAAATCCGGGAGAGGGCGGTATTTACCAGTCCCTTCCCCGAGAGCAACCAGGCAAATCGGGGAAGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--->
--*-
TTAG
    
----
----