Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000188740 (click for geneview)
Transcript ID ENST00000345105(link to ensembl)
Symbol Q86XG9_HUMAN
Localtion Chromosome:1:108630504:108640564:1 band: 1p13.3
Description PREDICTED: hypothetical protein XP_371388
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-R--W--L--L--P--P--S--L--L--S--E--S--E--L--Q--A--V--P--S--A--L--S--S--G--I--P--V--P--V--F--A--V--K--
CGCTGGCTGCTACCTCCCTCACTCTTGTCAGAGTCGGAGCTACAGGCAGTGCCTTCAGCTCTGAGCTCAGGCATCCCGGTCCCTGTTTTTGCGGTTAAGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------------------><---------------------------------------------------------
D--S--K--V--L--C--R--V--H--Q--L--F--L--N--L--P--G--S--T--S--S--A--T--N--V--S--M--V--V--S--A--D--P--L
ACTCTAAAGTGTTGTGTCGTGTTCATCAACTTTTTCTCAACCTCCCTGGCTCTACCTCTTCTGCCACAAACGTCAGCATGGTGGTATCTGCCGACCCTTT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--S--S--E--R--A--E--M--N--I--L--E--I--N--Q--E--L--R--S--Q--L--A--E--S--N--Q--Q--F--R--D--L--K--E--K-
GTCCAGCGAGAGGGCAGAGATGAACATCCTAGAAATCAACCAGGAATTGCGCTCGCAGCTGGCAGAGAGCAATCAGCAGTTCCGAGACCTCAAAGAGAAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------------------><--------------------------------------------
-F--L--I--T--Q--A--T--A--Y--S--L--A--N--Q--L--K--K--Y--K--C--E--E--Y--K--D--I--I--D--S--V--L--R--D--
TTCCTTATAACTCAAGCTACTGCCTACTCCCTGGCCAACCAGCTGAAGAAATACAAGTGTGAAGAGTACAAAGACATCATAGACTCTGTGCTGAGGGATG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------------------><--------------------------------------------
E--L--Q--S--M--E--K--L--A--E--K--L--R--Q--A--E--E--L--R--Q--Y--K--A--L--V--H--S--Q--A--K--E--L--T--Q
AACTGCAGTCCATGGAGAAGCTGGCAGAGAAGCTCAGGCAAGCTGAGGAGCTCAGGCAGTATAAAGCCCTGGTTCACTCTCAGGCAAAAGAGCTGACCCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--L--R--E--K--L--R--E--G--R--D--A--S--R--W--L--N--K--H--L--K--T--L--L--T--P--D--D--P--D--K--S--Q--G-
GTTACGGGAGAAGTTACGGGAAGGGAGAGATGCCTCCCGCTGGCTGAACAAGCATCTGAAAACCCTCCTCACTCCTGATGACCCTGACAAGTCCCAGGGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------------------------------------------><-----------------------------
-Q--D--L--R--E--Q--L--A--E--G--H--R--L--A--E--H--L--V--H--K--L--S--P--E--N--D--E--D--E--D--E--D--E--
CAGGACCTCCGAGAGCAGCTGGCTGAGGGGCACAGGCTGGCAGAGCACCTTGTTCACAAGCTGAGCCCAGAAAATGATGAAGATGAAGATGAGGATGAAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------------><--------------------------------------------------
D--D--K--D--E--E--V--E--K--V--Q--E--S--P--A--P--R--E--V--Q--K--T--E--E--K--E--V--P--Q--D--S--L--E--E
ACGACAAAGACGAGGAGGTTGAGAAAGTACAGGAATCACCTGCCCCCAGAGAGGTGCAGAAGACTGAAGAAAAGGAAGTCCCTCAGGACTCACTGGAGGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--C--A--V--T--C--S--N--S--H--N--P--S--N--S--N--Q--P--H--R--S--T--K--I--T--F--K--E--H--E--V--D--S--A-
ATGTGCTGTCACTTGTTCAAATAGTCACAACCCTTCTAACTCCAACCAGCCTCACAGGAGCACCAAAATCACATTTAAGGAACACGAAGTCGACTCTGCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------------------------><--------------------------------------
-L--V--V--E--S--E--H--P--H--D--E--E--E--E--A--L--N--I--P--P--E--N--Q--N--D--H--E--E--E--E--G--K--A--
CTGGTTGTAGAGAGTGAACACCCTCATGATGAAGAGGAGGAAGCTCTAAACATTCCCCCAGAAAATCAAAATGACCATGAGGAGGAGGAGGGGAAAGCGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------><--------------------------------------------------------------------------------------
P--V--P--P--R--H--H--D--K--S--N--S--Y--R--H--R--E--V--S--F--L--A--L--D--E--Q--K--V--C--S--A--Q--D--V
CAGTGCCCCCCAGACACCATGACAAGTCCAACTCTTACCGGCATCGTGAAGTCTCTTTCTTGGCATTGGATGAACAGAAAGTTTGCTCCGCTCAGGATGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------><----------------------------------------------
--A--R--D--Y--S--N--P--K--W--D--E--T--S--L--G--F--L--D--T--P--L--A--R--R--E--S--V--A--L--K--G--R--T-
TGCCAGGGATTACTCCAATCCCAAATGGGATGAAACCTCACTTGGCTTCCTCGACACACCCTTGGCCAGAAGAGAATCTGTTGCCTTGAAGGGTAGGACT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------->
-R--S--W--Q--H--S--S--H--A--N--*-
CGGTCCTGGCAGCATTCATCACATGCTAACTGA
                                 
---------------------------------
---------------------------------