Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000106580 (click for geneview)
Transcript ID ENST00000345862(link to ensembl)
Symbol XP_496917.1
Localtion Chromosome:7:133707488:133721556:1 band: 7q33
Description PREDICTED: similar to aldo-keto reductase family 1, member B10; aldose reductase-like 1; aldo-keto reductase family 1, member B11 (aldose reductase-like); aldose reductase-like peptide; aldose reductase-related protein; small intestine reductase ...
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<----------------------------------------------------------------><---------------------------------
-M--A--T--F--V--E--L--S--T--K--A--K--M--P--I--V--G--L--G--T--W--R--S--L--L--G--K--V--K--E--A--V--K--
ATGGCCACGTTTGTGGAGCTCAGTACAAAAGCCAAGATGCCCATTGTGGGCCTGGGCACTTGGAGGTCTCTTCTCGGCAAAGTGAAAGAAGCGGTGAAGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
V--A--I--D--A--E--Y--R--H--I--D--C--A--Y--F--Y--E--N--Q--H--E--V--G--E--A--I--Q--E--K--I--Q--E--K--A
TGGCCATTGATGCAGAATATCGCCACATTGACTGTGCCTATTTCTATGAGAATCAACATGAGGTGGGAGAAGCCATCCAAGAGAAGATCCAAGAGAAGGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------><-----------------------------------------------------------------
--V--M--R--E--D--L--F--I--V--S--K--V--W--P--T--F--F--E--R--P--L--V--R--K--A--F--E--K--T--L--K--D--L-
TGTGATGCGGGAGGACCTGTTCATCGTCAGCAAGGTGTGGCCCACTTTCTTTGAGAGACCCCTTGTGAGGAAAGCCTTTGAGAAGACCCTCAAGGACCTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------><------------------------------------------------
-K--L--S--Y--L--D--V--Y--L--I--H--W--P--Q--G--F--K--T--G--D--D--F--F--P--K--D--D--K--G--N--M--I--S--
AAGCTGAGCTATCTGGACGTCTATCTTATTCACTGGCCACAGGGATTCAAGACTGGGGATGACTTTTTCCCCAAAGATGATAAAGGTAATATGATCAGTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------><----------------------------------------------------------------------
G--K--G--T--F--L--D--A--W--E--A--M--E--E--L--V--D--E--G--L--V--K--A--L--G--V--S--N--F--N--H--F--Q--I
GAAAAGGAACGTTCTTGGATGCCTGGGAGGCCATGGAGGAGCTGGTGGACGAGGGGCTGGTGAAAGCCCTTGGGGTCTCAAATTTCAACCACTTCCAGAT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------------------------><-----------------------------------------------
--E--R--L--L--N--K--P--G--L--K--Y--K--P--V--T--N--Q--V--E--C--H--P--Y--L--T--Q--E--K--L--I--Q--Y--C-
CGAGAGGCTCTTGAACAAACCTGGACTGAAATATAAACCAGTGACTAACCAGGTTGAGTGTCACCCATACCTCACGCAGGAGAAACTGATCCAGTACTGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------><----------------------------------------
-H--S--K--G--I--T--V--T--A--Y--S--P--L--G--S--P--D--R--P--W--A--K--P--E--D--P--S--L--L--E--D--P--K--
CACTCCAAGGGCATCACCGTTACGGCCTACAGCCCCCTGGGCTCTCCGGATAGACCTTGGGCCAAACCTGAGGACCCTTCCCTGCTGGAGGATCCCAAGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------><----------------------------------------------------------
I--K--E--I--A--A--K--H--K--K--T--T--A--Q--V--L--I--R--F--H--I--Q--R--N--V--T--V--I--P--K--S--M--T--P
TTAAGGAGATTGCTGCAAAGCACAAAAAAACCACAGCCCAGGTTCTGATCCGTTTCCATATCCAGAGGAATGTGACAGTGATCCCCAAGTCTATGACACC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------><--------------------------------------------------------------------------
--A--H--I--V--E--N--I--Q--V--F--D--F--K--L--S--D--E--E--M--A--T--I--L--S--F--N--R--N--W--R--A--F--D-
AGCACACATTGTTGAGAACATTCAGGTCTTTGACTTTAAATTGAGTGATGAGGAGATGGCAACCATACTCAGCTTCAACAGAAACTGGAGGGCCTTTGAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------><----------------------------------------->
-F--K--E--F--S--H--L--E--D--F--P--F--D--A--E--Y--*-
TTCAAGGAATTCTCTCATTTGGAGGACTTTCCCTTCGATGCAGAATATTGA
                                                   
---------------------------------------------------
---------------------------------------------------