Sequences
EST Library Info
aor4Aorta
cbe3Cerebellum
cki1Kidney - RNA from China
csk2Skin - RNA from China
cst1Stomach - RNA from China
cte1Testicle - RNA from China
cut1Uterus - RNA from China
eru2Foetus 50 days, regio umbilicalis
hlv1Heart, left ventricle
sag1Salivary gland
spc2Spinal cord
sto2Stomach
Clusters
Oligos
SNPs

Gene ID ENSG00000147669 (click for geneview)
Transcript ID ENST00000353107(link to ensembl)
Symbol POLR2K
Localtion Chromosome:8:101232015:101235017:1 band: 8q22.2
Description DNA directed RNA polymerase II polypeptide K
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<-----------------------------------------------------------><--------------------------------------
-M--D--T--Q--K--D--V--Q--P--P--K--Q--Q--P--M--I--Y--I--C--G--E--C--H--T--E--N--E--I--K--S--R--D--P--
ATGGACACCCAGAAGGACGTTCAACCTCCAAAGCAGCAACCAATGATATATATCTGTGGAGAGTGTCACACAGAAAATGAAATAAAATCTAGGGATCCAA
:::::::: :::::::::::::::::.:::::.:::::.:::::::::::::::::::::   :::::::::::::::::::::::::: :::::::: :
ATGGACACACAGAAGGACGTTCAACCCCCAAAACAGCAGCCAATGATATATATCTGTGGA---TGTCACACAGAAAATGAAATAAAATCAAGGGATCCCA
-M--D--T--Q--K--D--V--Q--P--P--K--Q--Q--P--M--I--Y--I--C--G-----C--H--T--E--N--E--I--K--S--R--D--P--

-----------------------------------------------------><--------------------->
I--R--C--R--E--C--G--Y--R--I--M--Y--K--K--R--T--K--R--L--V--V--F--D--A--R--*-
TCAGATGCAGAGAATGTGGATACAGAATAATGTACAAGAAAAGGACTAAAAGATTGGTCGTTTTTGATGCTCGATGA
:: ::::::::::::::::.:::::::::::::::::::::::.:::::::::                        
TCCGATGCAGAGAATGTGGGTACAGAATAATGTACAAGAAAAGAACTAAAAGA------------------------
I--R--C--R--E--C--G--Y--R--I--M--Y--K--K--R--T--K--R-------------------------

Pig Consensus Sequence

>BGISUST0000890796
ATGGACACACAGAAGGACGTTCAACCCCCAAAACAGCAGCCAATGATATATATCTGTGGA---TGTCACACAGAAAATGAAATAAAATCAAGGGATCCCA
TCCGATGCAGAGAATGTGGGTACAGAATAATGTACAAGAAAAGAACTAAAAGA------------------------


>BGISUSP0000890796
MDTQKDVQPPKQQPMIYICG-CHTENEIKSRDPIRCRECGYRIMYKKRTKR--------