Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000198238 (click for geneview)
Transcript ID ENST00000354392(link to ensembl)
Localtion Chromosome:4:36077157:36087860:-1 band: 4p14
Description  
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<--------------------------------------------------------------------------------><-----------------
-I--I--S--A--H--C--N--F--H--L--L--G--S--S--N--S--P--T--S--A--S--R--V--A--G--I--T--D--Y--R--H--E--P--
ATTATCTCAGCTCACTGCAACTTCCACCTCCTGGGTTCAAGCAATTCTCCCACCTCAGCTTCCCGAGTAGCTGGAATTACAGATTACAGGCATGAGCCAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------->
P--H--P--A-
CCCACCCAGCC
           
-----------
-----------