Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000185864 (click for geneview)
Transcript ID ENST00000354563(link to ensembl)
Localtion Chromosome:16:30141887:30150297:-1 band: 16p11.2
Description PREDICTED: KIAA0220-like protein [Source:RefSeq_peptide_predicted;Acc:XP_290670]
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<----------------------------------><-----------------------------------------------------------><--
-Q--N--Q--W--K--E--E--D--R--Q--K--T--E--N--V--S--T--C--A--R--V--A--A--A--G--R--G--L--P--Q--M--Q--N--
CAAAATCAATGGAAAGAGGAAGACCGCCAGAAAACAGAAAATGTTTCAACGTGCGCAAGAGTTGCGGCGGCGGGCAGAGGACTACCACAAATGCAAAATC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----><----------------------><----------------------------------------------------------------------
P--P--A--R--K--A--L--C--N--W--V--R--M--A--A--A--E--H--R--H--S--S--G--L--P--Y--W--P--Y--L--T--A--E--T
CCCCCGCAAGAAAGGCTCTTTGCAACTGGGTCAGAATGGCGGCAGCGGAGCATCGTCATTCTTCAGGATTGCCCTACTGGCCCTACCTCACAGCTGAAAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--L--K--N--R--M--G--H--Q--P--P--P--P--T--Q--Q--H--S--I--T--D--N--S--L--S--L--K--T--P--P--E--C--V--L-
TTTAAAAAACAGGATGGGCCACCAGCCACCTCCTCCAACTCAACAACATTCTATAACTGATAACTCCCTGAGCCTCAAGACACCTCCCGAGTGTGTGCTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-T--P--L--P--P--S--A--D--D--N--L--K--T--P--P--E--C--V--L--T--P--L--P--P--S--A--D--D--N--L--K--T--P--
ACTCCCCTTCCACCCTCAGCGGATGATAATCTCAAGACACCTCCCGAGTGTGTGCTCACTCCCCTTCCACCCTCAGCGGATGATAATCTCAAGACACCTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
P--E--C--L--L--T--P--L--P--P--S--A--D--D--N--L--K--T--P--P--E--C--L--L--T--P--L--P--P--S--A--D--D--N
CTGAGTGTCTGCTCACTCCCCTTCCACCCTCAGCGGATGATAATCTCAAGACACCTCCTGAGTGTCTGCTCACTCCCCTTCCACCCTCAGCGGATGATAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--L--K--T--P--P--E--C--L--L--T--P--L--P--P--S--A--P--P--S--A--P--P--S--A--D--D--N--L--K--T--R--A--E-
TCTCAAGACACCTCCCGAGTGTCTGCTCACTCCCCTTCCACCCTCAGCTCCACCCTCAGCTCCACCCTCAGCGGATGATAATCTCAAGACACGTGCCGAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-C--L--L--H--P--L--P--P--S--A--D--D--N--L--K--T--P--S--E--R--Q--L--T--P--L--P--P--S--A--P--P--S--A--
TGTCTGCTCCATCCCCTTCCACCCTCAGCGGATGATAATCTCAAGACACCTTCCGAGCGTCAGCTCACTCCCCTTCCACCCTCAGCTCCACCCTCAGCAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
D--D--N--I--K--T--P--A--E--R--L--R--G--P--L--P--P--S--A--D--D--N--L--K--T--P--S--E--R--Q--L--T--P--L
ATGATAATATCAAGACACCTGCCGAGCGTCTGCGGGGGCCGCTTCCACCCTCAGCGGATGATAATCTCAAGACACCTTCCGAGCGTCAGCTCACTCCCCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--P--P--S--A--P--P--S--A--D--D--N--I--K--T--P--A--E--R--L--R--G--P--L--P--P--S--A--D--D--N--L--K--T-
TCCACCCTCAGCTCCACCCTCAGCAGATGATAATATCAAGACACCTGCCGAGCGTCTGCGGGGGCCGCTTCCACCCTCAGCGGATGATAATCTCAAGACA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-P--S--E--R--Q--L--T--P--L--P--P--S--A--P--P--S--A--D--D--N--I--K--T--P--A--E--R--L--R--G--P--L--P--
CCTTCCGAGCGTCAGCTCACTCCCCTTCCACCCTCAGCTCCACCCTCAGCAGATGATAATATCAAGACACCTGCCGAGCGTCTGCGGGGGCCGCTTCCAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
P--S--A--D--D--N--L--K--T--P--S--E--R--Q--L--T--P--L--P--P--S--A--P--P--S--A--D--D--N--I--K--T--P--A
CCTCAGCGGATGATAATCTCAAGACACCTTCCGAGCGTCAGCTCACTCCCCTTCCACCCTCAGCTCCACCCTCAGCAGATGATAATATCAAGACACCTGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--E--R--L--R--G--P--L--P--P--S--A--D--D--N--L--K--T--P--S--E--R--Q--L--T--P--L--P--P--S--A--P--P--S-
CGAGCGTCTGCGGGGGCCGCTTCCACCCTCAGCGGATGATAATCTCAAGACACCTTCCGAGCGTCAGCTCACTCCCCTTCCACCCTCAGCTCCACCCTCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-A--D--D--N--I--K--T--P--A--F--H--P--Q--R--M--I--I--S--R--H--L--P--S--V--S--S--L--P--F--H--P--Q--L--
GCAGATGATAATATCAAGACACCTGCCTTCCACCCTCAGCGGATGATAATCTCAAGACACCTTCCGAGCGTCAGCTCACTCCCCTTCCACCCTCAGCTCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
H--S--Q--Q--M--I--I--S--R--Y--L--L--S--V--C--G--F--R--F--H--H--Q--P--M--I--I--S--R--H--L--P--S--V--S
ACTCTCAGCAGATGATAATATCAAGATACCTGCTGAGCGTCTGCGGATTCCGCTTCCACCATCAGCCGATGATAATCTCAAGACACCTTCCGAGCGTCAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--S--L--P--F--H--P--Q--L--H--P--Q--Q--M--I--I--S--R--H--L--P--S--V--C--G--G--R--F--H--P--Q--R--M--I-
CTCACTCCCCTTCCACCCTCAGCTCCACCCTCAGCAGATGATAATATCAAGACACCTGCCGAGCGTCTGCGGGGGCCGCTTCCACCCTCAGCGGATGATA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-I--S--R--H--L--P--S--V--S--S--L--P--F--H--P--Q--L--H--P--Q--Q--M--I--I--S--R--H--L--P--S--V--C--G--
ATCTCAAGACACCTTCCGAGCGTCAGCTCACTCCCCTTCCACCCTCAGCTCCACCCTCAGCAGATGATAATATCAAGACACCTGCCGAGCGTCTGCGGGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
G--R--F--H--P--Q--R--M--I--I--S--R--H--L--P--S--V--S--S--L--P--F--H--P--Q--L--H--P--Q--Q--M--I--I--S
GCCGCTTCCACCCTCAGCGGATGATAATCTCAAGACACCTTCCGAGCGTCAGCTCACTCCCCTTCCACCCTCAGCTCCACCCTCAGCAGATGATAATATC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------><--------------------------------------------------------------------------------------
--R--H--L--P--S--V--C--G--G--R--F--H--P--Q--R--M--I--I--S--R--H--L--P--S--V--S--S--L--P--F--H--P--Q-
AAGACACCTGCCGAGCGTCTGCGGGGGCCGCTTCCACCCTCAGCGGATGATAATCTCAAGACACCTTCCGAGCGTCAGCTCACTCCCCTTCCACCCTCAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------><------------------------------------------------
-L--H--P--Q--Q--M--I--I--S--R--H--L--P--S--V--C--G--P--L--P--P--S--A--D--D--N--L--K--T--P--S--E--R--
CTCCACCCTCAGCAGATGATAATATCAAGACACCTGCCGAGCGTCTGCGGACCGCTTCCACCCTCAGCGGATGATAATCTCAAGACACCTTCCGAGCGTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
Q--L--T--P--L--P--P--S--A--P--P--S--A--D--D--N--I--K--T--P--A--E--R--L--R--G--P--L--P--P--S--A--D--D
AGCTCACTCCCCTTCCACCCTCAGCTCCACCCTCAGCAGATGATAATATCAAGACACCTGCCGAGCGTCTGCGGGGGCCGCTTCCACCCTCAGCGGATGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--N--L--K--T--P--S--E--R--Q--L--T--P--L--P--P--S--A--P--P--S--A--D--D--N--I--K--T--P--A--E--R--L--R-
TAATCTCAAGACACCTTCCGAGCGTCAGCTCACTCCCCTTCCACCCTCAGCTCCACCCTCAGCAGATGATAATATCAAGACACCTGCCGAGCGTCTGCGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-G--P--L--P--P--S--A--D--D--N--L--K--T--P--S--E--R--Q--L--T--P--L--P--P--S--A--P--P--S--A--D--D--N--
GGGCCGCTTCCACCCTCAGCGGATGATAATCTCAAGACACCTTCCGAGCGTCAGCTCACTCCCCTTCCACCCTCAGCTCCACCCTCAGCAGATGATAATA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
I--K--T--P--A--E--R--L--R--G--P--L--P--P--S--A--D--D--N--L--K--T--P--S--E--R--Q--L--T--P--L--P--P--S
TCAAGACACCTGCCGAGCGTCTGCGGGGGCCGCTTCCACCCTCAGCGGATGATAATCTCAAGACACCTTCCGAGCGTCAGCTCACTCCCCTTCCACCCTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------><-------------------------------------------------------
--A--P--P--S--A--D--D--N--I--K--T--P--A--E--P--P--E--P--K--R--R--R--V--G--D--V--E--P--S--R--K--P--K-
AGCTCCACCCTCAGCAGATGATAATATCAAGACACCTGCCGAGCCTCCCGAACCCAAGAGGCGGAGGGTCGGTGACGTGGAACCGTCACGCAAACCCAAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-R--R--R--A--A--D--V--E--P--S--S--P--K--P--K--R--R--R--V--G--D--V--E--P--S--R--K--P--K--R--R--R--A--
AGGCGGAGGGCCGCTGACGTGGAACCATCATCACCCAAACCCAAGAGGCGGAGGGTCGGTGATGTGGAACCGTCACGCAAACCCAAGAGGCGGAGGGCCG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
A--D--V--E--P--S--S--P--E--P--K--R--R--R--V--G--D--V--E--P--S--R--K--P--K--R--R--R--A--A--D--V--E--P
CTGACGTGGAACCATCATCACCCGAACCCAAGAGGCGGAGGGTCGGTGACGTGGAACCGTCACGCAAACCCAAGAGGCGGAGGGCCGCTGACGTGGAACC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

>
-
A
 
-
-