Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000198617 (click for geneview)
Transcript ID ENST00000354672(link to ensembl)
Symbol XP_499561.1
Localtion Chromosome:7:78820581:78820652:1 band: 7q21.11
Description PREDICTED: hypothetical protein XP_498432
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------->
-M--G--F--L--H--V--G--Q--A--G--L--E--L--L--T--S--G--D--P--P--T--S--A--S-
ATGGGGTTTCTCCATGTTGGTCAGGCTGGTCTCGAACTCCTGACCTCAGGTGATCCACCCACCTCGGCCTCC
                                                                        
------------------------------------------------------------------------
------------------------------------------------------------------------