Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000132207 (click for geneview)
Transcript ID ENST00000354723(link to ensembl)
Symbol SULT1A3
Localtion Chromosome:16:30113267:30122940:1 band: 16p11.2
Description Monoamine-sulfating phenol sulfotransferase (EC 2.8.2.1) (Aryl sulfotransferase 1A3) (Sulfotransferase, monoamine-preferring) (M-PST) (Thermolabile phenol sulfotransferase) (TL-PST) (Placental estrogen sulfotransferase) (Catecholamine-sulfating phenol sul [Source:Uniprot/SWISSPROT;Acc:P50224]
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--E--L--I--Q--D--T--S--R--P--P--L--E--Y--V--K--G--V--P--L--I--K--Y--F--A--E--A--L--G--P--L--Q--S--
ATGGAGCTGATCCAGGACACCTCCCGCCCGCCACTGGAGTACGTGAAGGGGGTCCCGCTCATCAAGTACTTTGCAGAGGCACTGGGGCCCCTGCAGAGCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------------------------><---------------------------------------------------
F--Q--A--R--P--D--D--L--L--I--N--T--Y--P--K--S--G--T--T--W--V--S--Q--I--L--D--M--I--Y--Q--G--G--D--L
TCCAAGCCCGACCTGATGACCTGCTCATCAACACCTACCCCAAGTCTGGCACCACCTGGGTGAGCCAGATACTGGACATGATCTACCAGGGCGGCGACCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------------------------------------><-------------------------
--E--K--C--N--R--A--P--I--Y--V--R--V--P--F--L--E--V--N--D--P--G--E--P--S--G--L--E--T--L--K--D--T--P-
AGAGAAGTGTAACCGGGCTCCCATCTACGTACGGGTGCCCTTCCTTGAGGTCAATGATCCAGGGGAACCCTCAGGGCTGGAGACTCTGAAAGACACACCG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------------------------------------------------><---------------------------
-P--P--R--L--I--K--S--H--L--P--L--A--L--L--P--Q--T--L--L--D--Q--K--V--K--V--V--Y--V--A--R--N--P--K--
CCCCCACGGCTCATCAAGTCACACCTGCCCCTGGCTCTGCTCCCTCAGACTCTGTTGGATCAGAAGGTCAAGGTGGTCTATGTTGCCCGAAACCCAAAGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------------------------------------------------------><
D--V--A--V--S--Y--Y--H--F--H--R--M--E--K--A--H--P--E--P--G--T--W--D--S--F--L--E--K--F--M--A--G--E--V
ACGTGGCGGTCTCCTACTACCATTTCCACCGTATGGAAAAGGCGCACCCTGAGCCTGGGACCTGGGACAGCTTCCTGGAAAAGTTCATGGCTGGAGAAGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------------------------------------------------------------------><-----
--S--Y--G--S--W--Y--Q--H--V--Q--E--W--W--E--L--S--R--T--H--P--V--L--Y--L--F--Y--E--D--M--K--E--N--P-
GTCCTACGGGTCCTGGTACCAGCACGTGCAGGAGTGGTGGGAGCTGAGCCGCACCCACCCTGTTCTCTACCTCTTCTATGAAGACATGAAGGAGAACCCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-K--R--E--I--Q--K--I--L--E--F--V--G--R--S--L--P--E--E--T--M--D--F--M--V--Q--H--T--S--F--K--E--M--K--
AAAAGGGAGATTCAAAAGATCCTGGAGTTTGTGGGGCGCTCCCTGCCAGAGGAGACCATGGACTTCATGGTTCAGCACACGTCGTTCAAGGAGATGAAGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------------------------------><------------------------
K--N--P--M--T--N--Y--T--T--V--P--Q--E--L--M--D--H--S--I--S--P--F--M--R--K--G--M--A--G--D--W--K--T--T
AGAACCCTATGACCAACTACACCACCGTCCCCCAGGAGCTCATGGACCACAGCATCTCCCCCTTCATGAGGAAAGGCATGGCTGGGGACTGGAAGACCAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------------------------------------------->
--F--T--V--A--Q--N--E--R--F--D--A--D--Y--A--E--K--M--A--G--C--S--L--S--F--R--S--E--L--*-
CTTCACCGTGGCGCAGAATGAGCGCTTCGATGCGGACTATGCGGAGAAGATGGCAGGCTGCAGCCTCAGCTTCCGCTCTGAGCTGTGA
                                                                                        
----------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------