Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000198398 (click for geneview)
Transcript ID ENST00000354905(link to ensembl)
Symbol NP_997199.1
Localtion Chromosome:3:191629150:191650367:-1 band: 3q28
Description SRSR846
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<-------------------------------------------------------------------------><------------------------
-M--S--R--S--R--L--F--S--V--T--S--A--I--S--T--I--G--I--L--C--L--P--L--F--Q--L--V--L--S--D--L--P--C--
ATGTCAAGATCCAGACTTTTCAGTGTCACCTCAGCGATCTCAACGATAGGGATCTTGTGTTTGCCGCTATTCCAGTTGGTGCTCTCGGACCTACCATGCG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------><-------------------------------------------><-----------------------------------------
E--E--D--E--M--C--V--N--Y--N--D--Q--H--P--N--G--W--Y--I--W--I--L--L--L--L--V--L--V--A--A--L--L--C--G
AAGAAGATGAAATGTGTGTAAATTATAATGACCAACACCCTAATGGCTGGTATATCTGGATCCTCCTGCTGCTGGTTTTGGTGGCAGCTCTTCTCTGTGG
                                                                 .::::::::.::::  :::..::::::: ::::::
-----------------------------------------------------------------TTGCTGCTGATTTTCCTGGTGGCTCTTCACTGTGG
------------------------------------------------------------------L--L--L--I--F--L--V--A--L--H--C--G

----------------------------------------------------------------------------------------------------
--A--V--V--L--C--L--Q--C--W--L--R--R--P--R--I--D--S--H--R--R--T--M--A--V--F--A--V--G--D--L--D--S--I-
AGCTGTGGTCCTCTGCCTCCAGTGCTGGCTGAGGAGACCCCGAATTGATTCTCACAGGCGCACCATGGCAGTTTTTGCTGTTGGAGACTTGGACTCTATT
::: ::: ::.::::::::::::::::: ::::::::.:::.:: : .:::::  ::.::::::.:::: :::::::::::::::::.::::::.:..::
AGCAGTGCTCTTCTGCCTCCAGTGCTGGGTGAGGAGATCCCAAAATTGTTCTCCAAGACGCACCGTGGCTGTTTTTGCTGTTGGAGATTTGGACCCCGTT
--A--V--L--F--C--L--Q--C--W--V--R--R--S--Q--N--C--S--P--R--R--T--V--A--V--F--A--V--G--D--L--D--P--V-

---><-----------------------------------------------------------------------------------------------
-Y--G--T--E--A--A--V--S--P--T--V--G--I--H--L--Q--T--Q--T--P--D--L--Y--P--V--P--A--P--C--F--G--P--L--
TATGGGACAGAAGCAGCTGTGAGTCCAACTGTTGGAATTCACCTTCAAACTCAAACCCCTGACCTATATCCTGTTCCTGCTCCATGTTTTGGCCCTTTAG
:::                                                                                                 
TAT-------------------------------------------------------------------------------------------------
-Y--------------------------------------------------------------------------------------------------

---------------------------------------->
G--S--P--P--P--Y--E--E--I--V--K--T--T--*-
GCTCCCCACCTCCATATGAAGAAATTGTAAAAACAACCTGA
                                         
-----------------------------------------
-----------------------------------------

Pig Consensus Sequence

>BGISUST0000889371
----------------------------------------------------------------------------------------------------
-----------------------------------------------------------------TTGCTGCTGATTTTCCTGGTGGCTCTTCACTGTGG
AGCAGTGCTCTTCTGCCTCCAGTGCTGGGTGAGGAGATCCCAAAATTGTTCTCCAAGACGCACCGTGGCTGTTTTTGCTGTTGGAGATTTGGACCCCGTT
TAT-------------------------------------------------------------------------------------------------
-----------------------------------------


>BGISUSP0000889371
-------------------------------------------------------LLLIFLVALHCGAVLFCLQCWVRRSQNCSPRRTVAVFAVGDLDPV
Y----------------------------------------------