Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000196112 (click for geneview)
Transcript ID ENST00000355258(link to ensembl)
Symbol Q8NBF4_HUMAN
Localtion Chromosome:7:323479:323943:-1 band: 7p22.3
Description Hypothetical protein FLJ33307.
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--Q--L--L--Q--V--R--T--T--N--T--L--R--R--L--P--G--T--P--L--M--P--S--A--G--A--V--R--V--V--A--S--V--
ATGCAGTTGTTACAGGTCAGGACTACAAACACGTTGAGGAGGCTGCCCGGGACCCCACTCATGCCGTCAGCAGGAGCCGTGAGAGTCGTGGCGTCTGTTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
Q--S--G--H--S--W--W--R--M--W--D--G--P--T--G--A--V--E--A--G--S--C--A--E--M--L--R--T--S--A--P--G--T--S
AGTCAGGTCACTCTTGGTGGAGGATGTGGGATGGACCCACAGGTGCCGTGGAGGCTGGCAGCTGTGCTGAGATGCTAAGGACCTCAGCTCCAGGCACCAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--C--P--N--L--S--F--L--L--G--Q--V--I--P--L--A--H--T--G--S--V--E--T--L--P--S--E--E--S--W--G--C--R--Q-
TTGTCCAAACCTGAGCTTCTTGTTGGGACAGGTCATTCCCCTGGCTCACACCGGCTCTGTGGAAACGCTGCCCTCAGAGGAGAGCTGGGGGTGTAGGCAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-R--A--S--P--L--P--P--S--T--A--P--M--A--V--S--A--S--H--R--G--G--T--G--T--R--T--W--L--V--D--P--T--L--
CGGGCGTCTCCCCTTCCACCCTCCACAGCCCCCATGGCAGTGTCAGCCTCTCACAGGGGAGGGACAGGGACACGGACCTGGCTTGTTGACCCCACACTGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------------------------------------->
S--R--D--T--S--P--L--G--G--Q--S--W--G--S--P--Q--P--S--R--G--A--*-
GCCGTGACACCAGCCCCCTGGGTGGCCAGTCTTGGGGGTCTCCTCAACCCAGCAGAGGGGCCTGA
                                                                 
-----------------------------------------------------------------
-----------------------------------------------------------------