Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000196317 (click for geneview)
Transcript ID ENST00000355462(link to ensembl)
Symbol O00361_HUMAN
Localtion Chromosome:16:33666655:33667671:-1 band: 16p11.2
Description P40.
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--G--K--K--Q--N--R--K--T--G--N--S--K--T--Q--S--A--S--P--P--P--K--E--R--S--S--S--P--A--T--E--Q--S--
ATGGGGAAAAAACAGAACAGAAAAACTGGAAACTCTAAAACGCAGAGCGCCTCTCCTCCTCCAAAGGAACGCAGTTCCTCACCAGCAACAGAACAAAGCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
W--M--E--N--D--F--D--E--L--R--E--E--G--F--R--R--S--N--Y--S--E--L--R--E--D--I--Q--T--K--G--K--E--V--E
GGATGGAGAATGATTTTGACGAGCTGAGAGAAGAAGGCTTCAGACGATCAAATTACTCTGAGCTACGGGAGGACATTCAAACCAAAGGCAAAGAAGTTGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--N--F--E--K--N--L--E--E--C--I--T--R--I--S--N--T--E--K--C--L--K--E--L--M--E--L--K--T--K--A--R--E--L-
AAACTTTGAAAAAAATTTAGAAGAATGTATAACTAGAATATCCAATACAGAGAAGTGCTTAAAGGAGCTGATGGAGCTGAAAACCAAGGCTCGAGAACTA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-R--E--E--C--R--S--L--R--S--R--C--D--Q--L--E--E--R--V--S--A--M--E--D--E--M--N--E--M--K--R--E--G--K--
CGTGAAGAATGCAGAAGCCTCAGGAGCCGATGCGATCAACTGGAAGAAAGGGTATCAGCAATGGAAGATGAAATGAATGAAATGAAGCGAGAAGGGAAGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
F--R--E--K--R--I--K--R--N--E--Q--S--L--Q--E--I--W--D--Y--V--K--R--P--N--L--R--L--I--G--V--P--E--S--D
TTAGAGAAAAAAGAATAAAAAGAAATGAGCAAAGCCTCCAAGAAATATGGGACTATGTGAAAAGACCAAATCTACGTCTGATTGGTGTACCTGAAAGTGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--V--E--N--G--T--K--L--E--N--T--L--Q--D--I--I--Q--E--N--F--P--N--L--A--R--Q--A--N--V--Q--I--Q--E--I-
TGTGGAGAATGGAACCAAGTTGGAAAACACTCTGCAGGATATTATCCAGGAGAACTTCCCCAATCTAGCAAGGCAGGCCAACGTTCAGATTCAGGAAATA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-Q--R--T--P--Q--R--Y--S--S--R--R--A--T--P--R--H--I--I--V--R--F--T--K--V--E--M--K--E--K--M--L--R--A--
CAGAGAACGCCACAAAGATACTCCTCGAGAAGAGCAACTCCAAGACACATAATTGTCAGATTCACCAAAGTTGAAATGAAGGAAAAAATGTTAAGGGCAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
A--R--E--K--G--R--V--T--L--K--G--K--P--I--R--L--T--A--D--L--S--A--E--T--L--Q--A--R--R--E--W--G--P--I
CCAGAGAGAAAGGTCGGGTTACCCTCAAAGGGAAGCCCATCAGACTAACAGCGGATCTCTCGGCAGAAACCCTACAAGCCAGAAGAGAGTGGGGGCCAAT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--F--N--I--L--K--E--K--N--F--Q--P--R--I--S--Y--P--A--K--L--S--F--I--S--E--G--E--I--K--Y--F--I--D--K-
ATTCAACATTCTTAAAGAAAAGAATTTTCAACCCAGAATTTCATATCCAGCCAAACTAAGCTTCATAAGTGAAGGAGAAATAAAATACTTTATAGACAAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-Q--M--L--R--D--F--V--T--T--R--P--A--L--K--E--L--L--K--E--A--L--N--M--E--R--N--N--R--Y--Q--P--L--Q--
CAAATGTTGAGAGATTTTGTCACCACCAGGCCTGCCCTAAAAGAGCTCCTGAAGGAAGCGCTAAACATGGAAAGGAACAACCGGTACCAGCCGCTGCAAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------->
N--H--A--K--M--*-
ATCATGCCAAAATGTAA
                 
-----------------
-----------------